Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12693
Trapped Gene
Zc3h10 (ENSMUSG00000039810)
Vector Insertion
Chr 10: 127982595 - 127983883
Public Clones (sanger) A001C07 (ggtc) 5SE305D06 (ggtc) D099C01 (ggtc) 3SE305D06 (ggtc)
IST14677H7 (tigm)
Private Clones OST149710 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000268134 (Chr10:127983884..127983947 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGACTTCACCTGAGCTACC Chr10:127983888..127983907 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000268134 (Chr10:127983884..127983947 -)
Downstram Exon
ENSMUSE00000369664 (Chr10:127980652..127982594 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGACTTCACCTGAGCTACC Chr10:127983888..127983907 59.87 60 TGCTGGAATCTGTGCTGTTC Chr10:127980863..127980882 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371052 Chr10:127984750..127984793 No primer for this exon
upstream ENSMUSE00000268134 Chr10:127983884..127983947 CGGACTTCACCTGAGCTACC Chr10:127983888..127983907 59.87 60

*** Putative Vector Insertion (Chr 10: 127982595 - 127983883) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000369664 Chr10:127980652..127982594 TGCTGGAATCTGTGCTGTTC Chr10:127980863..127980882 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGGGGTGAGGAAGGCTAT Chr10:127983846..127983866 59.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTGGGGTGAGGAAGGCTAT Chr10:127983846..127983866 59.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGTGATGTGGAGGTGGAGA Chr10:127983919..127983939 59.66 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGTGATGTGGAGGTGGAGA Chr10:127983919..127983939 59.66 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039810