Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12695
Trapped Gene
Eif2a (ENSMUSG00000027810)
Vector Insertion
Chr 3: 58341531 - 58343449
Public Clones F028C01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000255157 (Chr3:58341456..58341530 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGATGGGACATTGTTTGC Chr3:58341493..58341512 59.8 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000255157 (Chr3:58341456..58341530 +)
Downstram Exon
ENSMUSE00000255150 (Chr3:58343450..58343568 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGATGGGACATTGTTTGC Chr3:58341493..58341512 59.8 45 TCCCTTGTTAGCGACATTGA Chr3:58343483..58343502 59.27 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639198 Chr3:58329788..58330008 AACACCGACTCGCAGACTTT Chr3:58329878..58329897 59.91 50
upstream ENSMUSE00000255167 Chr3:58335009..58335078 ATGGACCACCACACTTCACA Chr3:58335039..58335058 59.85 50
upstream ENSMUSE00000255157 Chr3:58341456..58341530 AAGGATGGGACATTGTTTGC Chr3:58341493..58341512 59.8 45

*** Putative Vector Insertion (Chr 3: 58341531 - 58343449) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000255150 Chr3:58343450..58343568 TCCCTTGTTAGCGACATTGA Chr3:58343483..58343502 59.27 45
downstream ENSMUSE00000173227 Chr3:58344962..58345061 ACGATTTCAAACATGCTCCA Chr3:58345039..58345058 59.13 40
downstream ENSMUSE00000173230 Chr3:58345556..58345638 TTAACATTCCGGGCACAAAT Chr3:58345606..58345625 60.19 40
downstream ENSMUSE00000173219 Chr3:58348917..58348990 GGTTGGGTTCCAGGTGATAA Chr3:58348986..58349005 59.65 50
downstream ENSMUSE00000173213 Chr3:58349150..58349294 ATGAGGGGGCACCTTTACTT Chr3:58349192..58349211 59.83 50
downstream ENSMUSE00000173215 Chr3:58349422..58349538 TGGCTATTACCAGCACAGCA Chr3:58349448..58349467 60.42 50
downstream ENSMUSE00000173228 Chr3:58352315..58352886 GGCTATAGAAGGCTGCGTTG Chr3:58352476..58352495 60 55
downstream ENSMUSE00000173231 Chr3:58356491..58356604 TGGCTTGTCACTTCCTGGAT Chr3:58356547..58356566 60.66 50
downstream ENSMUSE00000173233 Chr3:58359457..58359573 TAGGAGCCGCATCACTTCTT Chr3:58359484..58359503 59.98 50
downstream ENSMUSE00000173229 Chr3:58360495..58360560 GCCTGCTCTTTTAGCTGCTC Chr3:58360532..58360551 59.5 55
downstream ENSMUSE00000392131 Chr3:58361043..58361341 ATGGCAATTCCATGAACACC Chr3:58361191..58361210 60.59 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGGAGCAATGGAGAAAAG Chr3:58341513..58341533 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGGAGCAATGGAGAAAAG Chr3:58341513..58341533 59.81 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027810