Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12708
Trapped Gene
Upf1 (ENSMUSG00000058301)
Vector Insertion
Chr 8: 72857874 - 72857971
Public Clones F012A01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000494397 (Chr8:72857972..72858146 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTCGCAAACTTGTCAAC Chr8:72857984..72858003 60.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000494397 (Chr8:72857972..72858146 -)
Downstram Exon
ENSMUSE00000487755 (Chr8:72857792..72857873 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTCGCAAACTTGTCAAC Chr8:72857984..72858003 60.44 50 GGCATCGTACATGGCAGTAG Chr8:72857816..72857835 59.18 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000508308 Chr8:72876677..72877178 CGAGTTCGAATTCACCGACT Chr8:72876781..72876800 60.26 50
upstream ENSMUSE00000507067 Chr8:72868125..72868264 ATGACAGTGTGGCCAAGACC Chr8:72868208..72868227 61 55
upstream ENSMUSE00000503574 Chr8:72867234..72867323 CTGCCTGCGTGGTTTACTGT Chr8:72867284..72867303 61.28 55
upstream ENSMUSE00000510662 Chr8:72865909..72866076 AGACCGTGCTGGAGTGCTAC Chr8:72865986..72866005 60.48 60
upstream ENSMUSE00000507971 Chr8:72865359..72865539 TTCTGTCATGGCTGGTCAAG Chr8:72865437..72865456 59.83 50
upstream ENSMUSE00000517434 Chr8:72864449..72864610 GCGTTACGAGGATGCTTACC Chr8:72864520..72864539 59.74 55
upstream ENSMUSE00000514355 Chr8:72863881..72863998 AATCGCCTTCTTCACTTTGC Chr8:72863929..72863948 59.46 45
upstream ENSMUSE00000511605 Chr8:72863642..72863740 GATCTGTCTGCGGTACAAAGG Chr8:72863695..72863715 59.75 52.38
upstream ENSMUSE00000516593 Chr8:72863223..72863331 TGTGGAAGTGACCCACAACT Chr8:72863263..72863282 58.99 50
upstream ENSMUSE00000480446 Chr8:72862979..72863138 TCCCTGACCTCAACCACTCT Chr8:72862982..72863001 59.68 55
upstream ENSMUSE00000485136 Chr8:72862785..72862903 GAGACCACTCAGCCTCATCC Chr8:72862858..72862877 59.8 60
upstream ENSMUSE00000482604 Chr8:72862296..72862460 TTGCACAACCAGATCAGGAA Chr8:72862305..72862324 60.24 45
upstream ENSMUSE00000479641 Chr8:72862105..72862219 TAAGCGCACAGCTGAGAGAG Chr8:72862116..72862135 59.64 55
upstream ENSMUSE00000484172 Chr8:72861388..72861531 ATGGTGCCTGTAGTCCTTGG Chr8:72861398..72861417 59.99 55
upstream ENSMUSE00000490629 Chr8:72860916..72861129 CTTCTACGAGGGCTCATTGC Chr8:72860934..72860953 59.98 55
upstream ENSMUSE00000486077 Chr8:72859553..72859670 TGGCACATCCTACCTCAACA Chr8:72859554..72859573 60.11 50
upstream ENSMUSE00000483169 Chr8:72859132..72859288 GCGCTCTTACTTGGTGCAGT Chr8:72859173..72859192 60.6 55
upstream ENSMUSE00000493592 Chr8:72858517..72858659 AGGGCATTGGGTTCCTAAAC Chr8:72858555..72858574 60.19 50
upstream ENSMUSE00000494397 Chr8:72857972..72858146 AGCCTCGCAAACTTGTCAAC Chr8:72857984..72858003 60.44 50

*** Putative Vector Insertion (Chr 8: 72857874 - 72857971) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487755 Chr8:72857792..72857873 GGCATCGTACATGGCAGTAG Chr8:72857816..72857835 59.18 55
downstream ENSMUSE00000488514 Chr8:72857170..72857331 CTGTCCGAAGTAGCCAGGTG Chr8:72857167..72857186 60.84 60
downstream ENSMUSE00000497214 Chr8:72856872..72857089 CATGGACACGTAACCCTGTG Chr8:72856904..72856923 59.87 55
downstream ENSMUSE00000498109 Chr8:72856519..72856641 GAGTGCCACGTCAATCTGTG Chr8:72856572..72856591 60.32 55
downstream ENSMUSE00000491289 Chr8:72855432..72856378 GTGGCCTCTGAAGCTCAAAC Chr8:72855602..72855621 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTAGCCTAATCGCCTTGC Chr8:72857908..72857928 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCTCGCAAACTTGTCAAC Chr8:72857982..72858002 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058301