Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12712
Trapped Gene
Hnrnpd (ENSMUSG00000000568)
Vector Insertion
Chr 5: 100393103 - 100393688
Public Clones F010D02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000188026 (Chr5:100393689..100393820 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000188026 (Chr5:100393689..100393820 -)
Downstram Exon
ENSMUSE00000188019 (Chr5:100393003..100393102 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000484747 Chr5:100407411..100407957 No primer for this exon
upstream ENSMUSE00000455342 Chr5:100405553..100405609 No primer for this exon
upstream ENSMUSE00000455322 Chr5:100396238..100396406 No primer for this exon
upstream ENSMUSE00000188023 Chr5:100395041..100395202 No primer for this exon
upstream ENSMUSE00000188026 Chr5:100393689..100393820 No primer for this exon

*** Putative Vector Insertion (Chr 5: 100393103 - 100393688) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188019 Chr5:100393003..100393102 No primer for this exon
downstream ENSMUSE00000188013 Chr5:100392750..100392896 No primer for this exon
downstream ENSMUSE00000542064 Chr5:100391534..100391631 No primer for this exon
downstream ENSMUSE00000482498 Chr5:100390028..100390352 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr5:100393618..100393638 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATCGTGACTGGGAAAACC Chr5:100393621..100393641 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000568