Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1272
Trapped Gene
Diap2 (ENSMUSG00000034480)
Vector Insertion
Chr X: 126862501 - 126862705
Public Clones DD0520 (sanger) XC499 (baygenomics) YHD374 (baygenomics) XG788 (baygenomics)
YHB146 (baygenomics) XH237 (baygenomics) YTC270 (baygenomics) TEA089 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000653826 (ChrX:126862502..126862704 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGATGAGACGGGAGTGAT ChrX:126862504..126862523 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000653826 (ChrX:126862502..126862704 +)
Downstram Exon
ENSMUSE00000622643 (ChrX:126862502..126863393 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGATGAGACGGGAGTGAT ChrX:126862504..126862523 59.93 55 GCACCTGACTGTAGGGCTTC ChrX:126862559..126862578 59.87 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000546634 ChrX:126284282..126284652 TTTGCCCTTGAGGAGACTTG ChrX:126284456..126284475 60.37 50
upstream ENSMUSE00000622646 ChrX:126284332..126284652 TTTGCCCTTGAGGAGACTTG ChrX:126284456..126284475 60.37 50
upstream ENSMUSE00000653827 ChrX:126284512..126284652 CCAACGAAGAGGAGACGAGA ChrX:126284618..126284637 60.52 55
upstream ENSMUSE00000695158 ChrX:126335931..126335963 No primer for this exon
upstream ENSMUSE00000546633 ChrX:126338549..126338725 TTCAGAAAATCTGCCACCAA ChrX:126338567..126338586 59.25 40
upstream ENSMUSE00000546630 ChrX:126355775..126355879 TAGCATCAAGCGTGAGATGG ChrX:126355828..126355847 59.97 50
upstream ENSMUSE00000695192 ChrX:126360463..126360483 No primer for this exon
upstream ENSMUSE00000546626 ChrX:126437436..126437575 TTTAACCAGCCATCCTGTCA ChrX:126437555..126437574 59.12 45
upstream ENSMUSE00000546625 ChrX:126473781..126473855 TGGGTCAACAACTTTGGCTA ChrX:126473782..126473801 59.17 45
upstream ENSMUSE00000546623 ChrX:126473939..126474008 CAGTGCCTGAAAGCATTTATGA ChrX:126473979..126474000 60.26 40.91
upstream ENSMUSE00000546621 ChrX:126477435..126477571 AGCAATTGACCCGAAACAAC ChrX:126477488..126477507 59.98 45
upstream ENSMUSE00000546617 ChrX:126478379..126478487 CAAACTTTTAGGGGGCATCA ChrX:126478385..126478404 59.93 45
upstream ENSMUSE00000546615 ChrX:126487209..126487319 TGCACTTGTCACCTCTCCAT ChrX:126487232..126487251 59.26 50
upstream ENSMUSE00000546613 ChrX:126490430..126490548 No primer for this exon
upstream ENSMUSE00000546602 ChrX:126491779..126491895 ACACTGCTGCGGAACCTTAC ChrX:126491823..126491842 60.32 55
upstream ENSMUSE00000546600 ChrX:126494580..126494698 GGCAGCGCATAGACTTTGAT ChrX:126494663..126494682 60.38 50
upstream ENSMUSE00000546598 ChrX:126497456..126497520 AATGAGCAAAAAGCAATGGAA ChrX:126497488..126497508 59.71 33.33
upstream ENSMUSE00000546593 ChrX:126501062..126501166 AGCTCGTCAGGAAGCTCAAG ChrX:126501079..126501098 59.89 55
upstream ENSMUSE00000546591 ChrX:126505815..126506129 TGGAGTACCTCCTCCACCAC ChrX:126505994..126506013 59.96 60
upstream ENSMUSE00000546588 ChrX:126507031..126507145 GCAAAACTGGCCTTGACATT ChrX:126507109..126507128 60.12 45
upstream ENSMUSE00000496232 ChrX:126581861..126581962 ATAGGAGTGGGCCTCCAAAG ChrX:126581891..126581910 60.46 55
upstream ENSMUSE00000498913 ChrX:126584903..126584997 TCAGTGAGGCCCTAATCCAG ChrX:126584978..126584997 60.21 55
upstream ENSMUSE00000419196 ChrX:126608358..126608459 AGCCTGAGCAGTTTGGTGTT ChrX:126608437..126608456 59.91 50
upstream ENSMUSE00000350456 ChrX:126623063..126623302 TGTTACGTCCTCGTCTCACG ChrX:126623079..126623098 59.9 55
upstream ENSMUSE00000207467 ChrX:126643788..126643917 CTGATGAGCTGGAGCATGTG ChrX:126643882..126643901 60.58 55
upstream ENSMUSE00000419154 ChrX:126713472..126713596 GCAGAATCGCACCATGATAA ChrX:126713558..126713577 59.65 45
upstream ENSMUSE00000371850 ChrX:126793613..126793777 TCATTTTTGACCCGAACACA ChrX:126793704..126793723 59.94 40
upstream ENSMUSE00000207471 ChrX:126824390..126824525 TGCAAAAGAGAAAGCGGAAC ChrX:126824452..126824471 60.5 45

*** Putative Vector Insertion (Chr X: 126862501 - 126862705) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000346672 ChrX:126862502..126862597 GCACCTGACTGTAGGGCTTC ChrX:126862559..126862578 59.87 60
downstream ENSMUSE00000622643 ChrX:126862502..126863393 GCACCTGACTGTAGGGCTTC ChrX:126862559..126862578 59.87 60
downstream ENSMUSE00000653826 ChrX:126862502..126862704 GCACCTGACTGTAGGGCTTC ChrX:126862559..126862578 59.87 60
downstream ENSMUSE00000546574 ChrX:126995407..126995471 CGAGAGCGAGATCTTTCCAG ChrX:126995446..126995465 60.23 55
downstream ENSMUSE00000695156 ChrX:126995407..127000370 GGCCTCTGTTGTAGCCTCTG ChrX:126998087..126998106 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGATGAGACGGGAGTGAT ChrX:126862505..126862525 59.93 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGATGAGACGGGAGTGAT ChrX:126862505..126862525 59.93 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034480