Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12753
Trapped Gene
Sgol1 (ENSMUSG00000023940)
Vector Insertion
Chr 17: 53827446 - 53828535
Public Clones M123H06 (ggtc) (ggtc) M123H06 (ggtc) 5SE142E01 (ggtc) (ggtc)
W262F02 (ggtc) (ggtc)
Private Clones OST418920 (lexicon) OST415172 (lexicon) OST401405 (lexicon) OST303206 (lexicon)
OST246554 (lexicon) OST194621 (lexicon) OST87621 (lexicon) OST83682 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000345240 (Chr17:53828536..53828658 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACGCAGAATTTCGAATGTG Chr17:53828604..53828623 58.77 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000345240 (Chr17:53828536..53828658 -)
Downstram Exon
ENSMUSE00000388704 (Chr17:53827315..53827445 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACGCAGAATTTCGAATGTG Chr17:53828604..53828623 58.77 40 GCTAAGGCAGGTGGGTCATA Chr17:53827372..53827391 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000345240 Chr17:53828536..53828658 AACGCAGAATTTCGAATGTG Chr17:53828604..53828623 58.77 40

*** Putative Vector Insertion (Chr 17: 53827446 - 53828535) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000388704 Chr17:53827315..53827445 GCTAAGGCAGGTGGGTCATA Chr17:53827372..53827391 60.1 55
downstream ENSMUSE00000501452 Chr17:53827036..53827183 AATCCCCGCCAAATTTTTAT Chr17:53827057..53827076 59.53 35
downstream ENSMUSE00000136522 Chr17:53826409..53826605 TTTCTCAGTTGCAGGATGACA Chr17:53826466..53826486 59.43 42.86
downstream ENSMUSE00000136524 Chr17:53822879..53822955 TTGTCAATGCTGGAGACCAC Chr17:53822890..53822909 59.68 50
downstream ENSMUSE00000136526 Chr17:53820770..53820813 No primer for this exon
downstream ENSMUSE00000136528 Chr17:53818235..53819026 AAATCGCAACCCTGTGTCTC Chr17:53818962..53818981 60.12 50
downstream ENSMUSE00000136519 Chr17:53816232..53816421 TGGTGCTACACCTGCGTTTA Chr17:53816241..53816260 60.32 50
downstream ENSMUSE00000136521 Chr17:53815381..53816036 AGAAGGGATCCTCACCCACT Chr17:53815605..53815624 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCTCCGACCGGACGTAAT Chr17:53828480..53828500 61.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGGTTGCATCTGCTCGTC Chr17:53828552..53828572 63.28 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGAGTGTCACGTGATGGTGT Chr17:53828645..53828665 59.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAGTGTCACGTGATGGTGT Chr17:53828645..53828665 59.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023940