Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12754
Trapped Gene
Nck1 (ENSMUSG00000032475)
Vector Insertion
Chr 9: 100409092 - 100446413
Public Clones M094E04 (ggtc) IST10034D11 (tigm) IST14509G9 (tigm) IST14202A7 (tigm)
IST14260B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219928 (Chr9:100446414..100446472 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219928 (Chr9:100446414..100446472 -)
Downstram Exon
ENSMUSE00000219929 (Chr9:100408848..100409091 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATGCTTTCCGAGCACTGTTT Chr9:100408856..100408875 59.88 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219928 Chr9:100446414..100446472 No primer for this exon

*** Putative Vector Insertion (Chr 9: 100409092 - 100446413) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219929 Chr9:100408848..100409091 ATGCTTTCCGAGCACTGTTT Chr9:100408856..100408875 59.88 45
downstream ENSMUSE00000706789 Chr9:100408848..100409073 ATGCTTTCCGAGCACTGTTT Chr9:100408856..100408875 59.88 45
downstream ENSMUSE00000693492 Chr9:100407145..100407275 TGACACAGCTCCGGGATAAT Chr9:100407195..100407214 60.48 50
downstream ENSMUSE00000219930 Chr9:100397677..100398389 GTCATTTTCCGGCTTTTCAA Chr9:100397916..100397935 60.05 40
downstream ENSMUSE00000394476 Chr9:100395424..100396090 AGTACAATTGGCCCAGCACT Chr9:100395792..100395811 59.62 50
downstream ENSMUSE00000633171 Chr9:100392712..100396090 GGTGTCCGTACTCTGGCAAT Chr9:100393103..100393122 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr9:100413345..100413365 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATACAAGGGCAGCGAGTTG Chr9:100413437..100413457 60.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATCTTGATGTTGGGGCAGAG Chr9:100413487..100413507 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAGCCGTGACTGGGAAAACC Chr9:100413406..100413426 63.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032475