Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12774
Trapped Gene
Cxcl12 (ENSMUSG00000061353)
Vector Insertion
Chr 6: 117126103 - 117131385
Public Clones F023B07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000465553 (Chr6:117126104..117131385 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTAGTGGCTCCCCAGGTTT Chr6:117128906..117128925 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000465553 (Chr6:117126104..117131385 +)
Downstram Exon
ENSMUSE00000693466 (Chr6:117128601..117131384 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTAGTGGCTCCCCAGGTTT Chr6:117128906..117128925 59.99 55 GAGACAGTCTTGCGGACACA Chr6:117129158..117129177 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693463 Chr6:117118553..117118734 TTTCACTCTCGGTCCACCTC Chr6:117118599..117118618 60.24 55
upstream ENSMUSE00000378141 Chr6:117118581..117118734 TTTCACTCTCGGTCCACCTC Chr6:117118599..117118618 60.24 55
upstream ENSMUSE00000693471 Chr6:117118592..117118734 TTTCACTCTCGGTCCACCTC Chr6:117118599..117118618 60.24 55
upstream ENSMUSE00000195603 Chr6:117121500..117121617 CCAACGTCAAGCATCTGAAA Chr6:117121563..117121582 59.84 45
upstream ENSMUSE00000515209 Chr6:117123510..117123596 TGTGCATTGACCCGAAATTA Chr6:117123539..117123558 59.93 40
upstream ENSMUSE00000693460 Chr6:117123510..117125087 AGTGGCTCTATGGGCTCTGA Chr6:117124548..117124567 59.97 55

*** Putative Vector Insertion (Chr 6: 117126103 - 117131385) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465553 Chr6:117126104..117131385 AAACCTGGGGAGCCACTACT Chr6:117128928..117128947 59.99 55
downstream ENSMUSE00000693466 Chr6:117128601..117131384 GAGACAGTCTTGCGGACACA Chr6:117129158..117129177 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACTGTTAATCGCCTTGCAG Chr6:117129147..117129168 59.53 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTGTCGTGACTGGGAAAA Chr6:117129148..117129168 58.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061353