Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12775
Trapped Gene
Scgb1c1 (ENSMUSG00000038801)
Vector Insertion
Chr 7: 148032147 - 148032498
Public Clones CMHD-GT_367A5-3 (cmhd)
Private Clones OST11304 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000333540 (Chr7:148031947..148032146 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTGGGCAAGTACAATGTC Chr7:148032037..148032056 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000333540 (Chr7:148031947..148032146 +)
Downstram Exon
ENSMUSE00000526256 (Chr7:148032499..148032667 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTGGGCAAGTACAATGTC Chr7:148032037..148032056 60.38 55 CGTGTTTCGGGTCTGCTTAT Chr7:148032550..148032569 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000235560 Chr7:148031476..148031530 No primer for this exon
upstream ENSMUSE00000333540 Chr7:148031947..148032146 CCCTGGGCAAGTACAATGTC Chr7:148032037..148032056 60.38 55

*** Putative Vector Insertion (Chr 7: 148032147 - 148032498) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000526256 Chr7:148032499..148032667 CGTGTTTCGGGTCTGCTTAT Chr7:148032550..148032569 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCGAGACTAATCGCCTTG Chr7:148032189..148032209 60.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGCAGTTCTTCCGAGACC Chr7:148032179..148032199 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038801