Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12782
Trapped Gene
Ube2l3 (ENSMUSG00000038965)
Vector Insertion
Chr 16: 17152105 - 17154376
Public Clones CMHD-GT_369C1-3 (cmhd)
Private Clones OST452165 (lexicon) OST390858 (lexicon) OST292511 (lexicon) OST283729 (lexicon)
OST278268 (lexicon) OST250934 (lexicon) OST250550 (lexicon) OST209885 (lexicon)
OST204891 (lexicon) OST165524 (lexicon) OST155780 (lexicon) OST128050 (lexicon)
OST112183 (lexicon) OST61929 (lexicon) OST34067 (lexicon) OST30754 (lexicon)
OST22316 (lexicon) OST22272 (lexicon) OST20315 (lexicon) OST13032 (lexicon)
OST12830 (lexicon) OST11081 (lexicon) OST7641 (lexicon) OST3452 (lexicon)
OST2240 (lexicon) OST2080 (lexicon) OST1179 (lexicon) OST947 (lexicon)
OST936 (lexicon) OST842 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000629265 (Chr16:17153418..17154375 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTTCGATTCCCACTTCCA Chr16:17153846..17153865 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000629265 (Chr16:17153418..17154375 -)
Downstram Exon
ENSMUSE00000517946 (Chr16:17152106..17154375 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTTCGATTCCCACTTCCA Chr16:17153846..17153865 60.04 45 GACGGCTTCTCTTTGTTTGC Chr16:17153637..17153656 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703894 Chr16:17202589..17202742 CCTTTCTAATGGGCACATGG Chr16:17202609..17202628 60.32 50
upstream ENSMUSE00000645501 Chr16:17201528..17201563 No primer for this exon
upstream ENSMUSE00000703893 Chr16:17201528..17201726 TTCTCTATTCCGCGCTCTTC Chr16:17201650..17201669 59.69 50
upstream ENSMUSE00000703899 Chr16:17201528..17201587 AGCAGCACCAGATCCAAGAT Chr16:17201553..17201572 59.83 50
upstream ENSMUSE00000562491 Chr16:17176505..17176600 AGCTTGAAGAGATCCGCAAA Chr16:17176580..17176599 60.1 45
upstream ENSMUSE00000520774 Chr16:17160083..17160269 TCAAACCACCCAAGATCACA Chr16:17160186..17160205 59.94 45
upstream ENSMUSE00000703898 Chr16:17154353..17154375 No primer for this exon
upstream ENSMUSE00000629265 Chr16:17153418..17154375 CTTTTCGATTCCCACTTCCA Chr16:17153846..17153865 60.04 45
upstream ENSMUSE00000703897 Chr16:17153403..17153607 CCCCATGGTCCCTATCTGTA Chr16:17153582..17153601 59.62 55
upstream ENSMUSE00000517946 Chr16:17152106..17154375 CTTTTCGATTCCCACTTCCA Chr16:17153846..17153865 60.04 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCTCATAGCACTGGTGAA Chr16:17154346..17154366 59.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCTCATAGCACTGGTGAA Chr16:17154346..17154366 59.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038965