Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12783
Trapped Gene
AC153368.5 (ENSMUSG00000078449)
Vector Insertion
Chr 10: 45595408 - 45595449
Public Clones CMHD-GT_441G4-3 (cmhd) CMHD-GT_466F7-3 (cmhd) CMHD-GT_361A11-3 (cmhd) CMHD-GT_95D12-3 (cmhd)
CMHD-GT_98D1-3 (cmhd) CMHD-GT_380A5-3 (cmhd) CMHD-GT_498B4-3 (cmhd) CMHD-GT_369B5-3 (cmhd)
CMHD-GT_532B12-3 (cmhd) CMHD-GT_441D11-3 (cmhd) CMHD-GT_502D3-3 (cmhd) CMHD-GT_389D3-3 (cmhd)
CMHD-GT_443C11-3 (cmhd) CMHD-GT_359C2-3 (cmhd) CMHD-GT_242G4-3 (cmhd)
Private Clones OST473468 (lexicon) OST473367 (lexicon) OST471778 (lexicon) OST466585 (lexicon)
OST456827 (lexicon) OST429288 (lexicon) OST425915 (lexicon) OST411873 (lexicon)
OST404680 (lexicon) OST404650 (lexicon) OST391436 (lexicon) OST390390 (lexicon)
OST384716 (lexicon) OST384712 (lexicon) OST382418 (lexicon) OST373554 (lexicon)
OST346561 (lexicon) OST338236 (lexicon) OST337984 (lexicon) OST334768 (lexicon)
OST318775 (lexicon) OST316731 (lexicon) OST307391 (lexicon) OST298750 (lexicon)
OST298057 (lexicon) OST295404 (lexicon) OST288208 (lexicon) OST284988 (lexicon)
OST279696 (lexicon) OST276342 (lexicon) OST275954 (lexicon) OST271103 (lexicon)
OST269851 (lexicon) OST260963 (lexicon) OST259086 (lexicon) OST258208 (lexicon)
OST257599 (lexicon) OST243894 (lexicon) OST242770 (lexicon) OST233581 (lexicon)
OST221887 (lexicon) OST213521 (lexicon) OST210865 (lexicon) OST200928 (lexicon)
OST200101 (lexicon) OST194741 (lexicon) OST192817 (lexicon) OST180987 (lexicon)
OST177727 (lexicon) OST172734 (lexicon) OST172542 (lexicon) OST135832 (lexicon)
OST131077 (lexicon) OST130460 (lexicon) OST128822 (lexicon) OST123509 (lexicon)
OST108226 (lexicon) OST104757 (lexicon) OST104371 (lexicon) OST96668 (lexicon)
OST84961 (lexicon) OST83459 (lexicon) OST75429 (lexicon) OST71021 (lexicon)
OST56948 (lexicon) OST33473 (lexicon) OST29866 (lexicon) OST29132 (lexicon)
OST29128 (lexicon) OST29035 (lexicon) OST28917 (lexicon) OST28871 (lexicon)
OST28682 (lexicon) OST28666 (lexicon) OST28381 (lexicon) OST27972 (lexicon)
OST27921 (lexicon) OST26675 (lexicon) OST26384 (lexicon) OST26136 (lexicon)
OST25790 (lexicon) OST25315 (lexicon) OST25129 (lexicon) OST24958 (lexicon)
OST24752 (lexicon) OST23220 (lexicon) OST23202 (lexicon) OST21696 (lexicon)
OST21203 (lexicon) OST20827 (lexicon) OST20282 (lexicon) OST20202 (lexicon)
OST19243 (lexicon) OST18864 (lexicon) OST18833 (lexicon) OST18765 (lexicon)
OST18762 (lexicon) OST18576 (lexicon) OST18505 (lexicon) OST17391 (lexicon)
OST17364 (lexicon) OST17122 (lexicon) OST17111 (lexicon) OST16731 (lexicon)
OST16452 (lexicon) OST16242 (lexicon) OST16113 (lexicon) OST15963 (lexicon)
OST15627 (lexicon) OST14979 (lexicon) OST14962 (lexicon) OST14523 (lexicon)
OST13874 (lexicon) OST13857 (lexicon) OST13777 (lexicon) OST13485 (lexicon)
OST13201 (lexicon) OST13189 (lexicon) OST13025 (lexicon) OST12866 (lexicon)
OST12847 (lexicon) OST12744 (lexicon) OST12577 (lexicon) OST12530 (lexicon)
OST12113 (lexicon) OST10755 (lexicon) OST10631 (lexicon) OST10485 (lexicon)
OST9703 (lexicon) OST9578 (lexicon) OST9419 (lexicon) OST7975 (lexicon)
OST7865 (lexicon) OST7393 (lexicon) OST7168 (lexicon) OST7166 (lexicon)
OST7106 (lexicon) OST6997 (lexicon) OST6778 (lexicon) OST6663 (lexicon)
OST6604 (lexicon) OST6448 (lexicon) OST5963 (lexicon) OST5619 (lexicon)
OST2345 (lexicon) OST2247 (lexicon) OST1890 (lexicon) OST929 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666400 (Chr10:45595097..45595407 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTGCATCGTCACCAATGT Chr10:45595244..45595263 60.46 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666400 (Chr10:45595097..45595407 +)
Downstram Exon
ENSMUSE00000666399 (Chr10:45595450..45595651 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTGCATCGTCACCAATGT Chr10:45595244..45595263 60.46 50 CACGCAGCCATTCTTATCAA Chr10:45595588..45595607 59.83 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666400 Chr10:45595097..45595407 GTGTGCATCGTCACCAATGT Chr10:45595244..45595263 60.46 50

*** Putative Vector Insertion (Chr 10: 45595408 - 45595449) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666399 Chr10:45595450..45595651 CACGCAGCCATTCTTATCAA Chr10:45595588..45595607 59.83 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGGCTACAACGTCAAGTTT Chr10:45595420..45595440 60.17 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGGCTACAACGTCAAGTTT Chr10:45595420..45595440 60.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078449