Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12786
Trapped Gene
A830080D01Rik (ENSMUSG00000044150)
Vector Insertion
Chr X: 156030002 - 156031014
Public Clones CMHD-GT_368B3-3 (cmhd)
Private Clones OST54935 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000543674 (ChrX:156030003..156031013 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGGCACTCTTTGTTGATG ChrX:156030248..156030267 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000543674 (ChrX:156030003..156031013 +)
Downstram Exon
ENSMUSE00000691765 (ChrX:156030003..156031013 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGGCACTCTTTGTTGATG ChrX:156030248..156030267 60.11 50 AACAAAGAGTGCCCCTCAAA ChrX:156030266..156030285 59.71 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000440515 ChrX:155970600..155970767 GGCTCTGGTGACGACTTCTC ChrX:155970742..155970761 59.99 60
upstream ENSMUSE00000402605 ChrX:155986171..155986247 AAAGTGGATCAGGCAGCTCA ChrX:155986176..155986195 60.94 50
upstream ENSMUSE00000714689 ChrX:155986171..155986247 AAAGTGGATCAGGCAGCTCA ChrX:155986176..155986195 60.94 50
upstream ENSMUSE00000343320 ChrX:155989683..155990306 CCTCAGATGTCACTGGCAGA ChrX:155990158..155990177 59.98 55
upstream ENSMUSE00000372666 ChrX:155991176..155991826 TGGAAGCCTGAGCATTCTTT ChrX:155991276..155991295 59.96 45
upstream ENSMUSE00000410616 ChrX:155993407..155993582 TTTGGTTGCTATTGGCAAAAC ChrX:155993449..155993469 59.99 38.1
upstream ENSMUSE00000359817 ChrX:155995375..155995489 TGCAGATTTCAATCAAACGAA ChrX:155995442..155995462 59.29 33.33
upstream ENSMUSE00000397778 ChrX:155996267..155996330 No primer for this exon
upstream ENSMUSE00000388572 ChrX:155997770..155997885 No primer for this exon
upstream ENSMUSE00000691768 ChrX:156004360..156004474 TTCGTGCTGATGGATTTCAA ChrX:156004398..156004417 60.2 40
upstream ENSMUSE00000543676 ChrX:156005851..156005946 GCAGAGAAAAGATGCCATTGA ChrX:156005862..156005882 60.35 42.86
upstream ENSMUSE00000691767 ChrX:156005851..156005946 GCAGAGAAAAGATGCCATTGA ChrX:156005862..156005882 60.35 42.86
upstream ENSMUSE00000543675 ChrX:156012877..156013029 ATACCAGCGCTTACGGTTTG ChrX:156012951..156012970 60.15 50
upstream ENSMUSE00000691766 ChrX:156012877..156013029 ATACCAGCGCTTACGGTTTG ChrX:156012951..156012970 60.15 50

*** Putative Vector Insertion (Chr X: 156030002 - 156031014) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000543674 ChrX:156030003..156031013 AACAAAGAGTGCCCCTCAAA ChrX:156030266..156030285 59.71 45
downstream ENSMUSE00000691765 ChrX:156030003..156031013 AACAAAGAGTGCCCCTCAAA ChrX:156030266..156030285 59.71 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCCAAGGACAAACAACCT ChrX:156030016..156030036 60.53 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCCAAGGACAAACAACCT ChrX:156030016..156030036 60.53 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044150