Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12791
Trapped Gene
Igll1 (ENSMUSG00000075370)
Vector Insertion
Chr 16: 16861228 - 16862521
Public Clones CMHD-GT_397A1-3 (cmhd) CMHD-GT_370A5-3 (cmhd) CMHD-GT_377B11-3 (cmhd) CMHD-GT_106E1-3 (cmhd)
Private Clones OST201074 (lexicon) OST190727 (lexicon) OST90604 (lexicon) OST23049 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000645533 (Chr16:16862522..16862637 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTCCATCTAAGCCCCAGT Chr16:16862564..16862583 60.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000645533 (Chr16:16862522..16862637 -)
Downstram Exon
ENSMUSE00000645532 (Chr16:16860908..16861227 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTCCATCTAAGCCCCAGT Chr16:16862564..16862583 60.6 55 GGGTAGAATTCGCTCACCAA Chr16:16861103..16861122 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703998 Chr16:16863789..16864078 TGCTGCTGTTGGGTCTAGTG Chr16:16863899..16863918 60.05 55
upstream ENSMUSE00000645533 Chr16:16862522..16862637 GCTTCCATCTAAGCCCCAGT Chr16:16862564..16862583 60.6 55

*** Putative Vector Insertion (Chr 16: 16861228 - 16862521) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645532 Chr16:16860908..16861227 GGGTAGAATTCGCTCACCAA Chr16:16861103..16861122 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTAATCGCCTTGCAGCAC Chr16:16862453..16862473 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGAAGTCCATTCGTGAC Chr16:16862464..16862484 60.51 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075370