Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12795
Trapped Gene
Gipc2 (ENSMUSG00000039131)
Vector Insertion
Chr 3: 151757260 - 151765582
Public Clones CMHD-GT_368G4-3 (cmhd) PSTVUpb15h11 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000260044 (Chr3:151765583..151765664 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCAATCGGAAAGGTTGAT Chr3:151765626..151765645 60.83 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000260044 (Chr3:151765583..151765664 -)
Downstram Exon
ENSMUSE00000394566 (Chr3:151756807..151757259 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCAATCGGAAAGGTTGAT Chr3:151765626..151765645 60.83 45 CCCAGAGTCTCGTCAAGAGC Chr3:151757162..151757181 60.13 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346457 Chr3:151828612..151828875 GAGCTCTACGCCAAGATTGC Chr3:151828640..151828659 60.12 55
upstream ENSMUSE00000260059 Chr3:151800537..151800722 TCATATTTGCCCACGTGAAA Chr3:151800627..151800646 59.93 40
upstream ENSMUSE00000260054 Chr3:151791000..151791180 GTGTGGGGGATCATATCGAA Chr3:151791118..151791137 60.55 50
upstream ENSMUSE00000260047 Chr3:151770905..151771011 CTCCGTCTGAGATCGAAAGG Chr3:151770927..151770946 59.94 55
upstream ENSMUSE00000260044 Chr3:151765583..151765664 AGGCAATCGGAAAGGTTGAT Chr3:151765626..151765645 60.83 45

*** Putative Vector Insertion (Chr 3: 151757260 - 151765582) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000394566 Chr3:151756807..151757259 CCCAGAGTCTCGTCAAGAGC Chr3:151757162..151757181 60.13 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCAGCTTAATCGCCTTGC Chr3:151759519..151759539 60.48 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGCCATTGTCATCATCCA Chr3:151759562..151759582 58.93 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039131