Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1281
Trapped Gene
2810026P18Rik (ENSMUSG00000032424)
Vector Insertion
Chr 9: 88416555 - 88416755
Public Clones DD0426 (sanger) AA0055 (sanger) AA0178 (sanger) AF0008 (sanger)
DB0251 (sanger) AQ0291 (sanger) XT0393 (sanger) AW0592 (sanger)
AD0332 (sanger) AG0447 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219689 (Chr9:88416756..88416813 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAATGCTGACCAGTGAGATG Chr9:88416793..88416813 59.85 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219689 (Chr9:88416756..88416813 -)
Downstram Exon
ENSMUSE00000219687 (Chr9:88416488..88416554 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAATGCTGACCAGTGAGATG Chr9:88416793..88416813 59.85 47.62 ACTGGCATCTCTCGCAAGTT Chr9:88416498..88416517 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219688 Chr9:88417322..88417711 ATTCGTACTAAGCGGCCTGA Chr9:88417512..88417531 59.87 50
upstream ENSMUSE00000219686 Chr9:88417145..88417219 GAGCCCAAAGCATCTGAGAG Chr9:88417192..88417211 60.1 55
upstream ENSMUSE00000219689 Chr9:88416756..88416813 TGAATGCTGACCAGTGAGATG Chr9:88416793..88416813 59.85 47.62

*** Putative Vector Insertion (Chr 9: 88416555 - 88416755) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219687 Chr9:88416488..88416554 ACTGGCATCTCTCGCAAGTT Chr9:88416498..88416517 60.02 50
downstream ENSMUSE00000233255 Chr9:88415893..88416286 TTCATTCGCACGTCTTGTGT Chr9:88416237..88416256 60.31 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr9:88416684..88416704 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000032424