Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12824
Trapped Gene
Usp10 (ENSMUSG00000031826)
Vector Insertion
Chr 8: 122460489 - 122465012
Public Clones (sanger) P127E11 (ggtc) CMHD-GT_373A5-3 (cmhd) IST14924B5 (tigm)
Private Clones OST237046 (lexicon) OST55890 (lexicon) OST50969 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000317164 (Chr8:122460431..122460488 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCCTCCATACAGTGGGACT Chr8:122460432..122460451 59.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000317164 (Chr8:122460431..122460488 +)
Downstram Exon
ENSMUSE00000213445 (Chr8:122465013..122466038 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCCTCCATACAGTGGGACT Chr8:122460432..122460451 59.38 55 CCCGGGGATTCAAGTATTTT Chr8:122465727..122465746 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678738 Chr8:122434752..122434839 GCACCGAACCTCATTGAGAC Chr8:122434791..122434810 60.67 55
upstream ENSMUSE00000678684 Chr8:122454748..122454765 No primer for this exon
upstream ENSMUSE00000317169 Chr8:122455749..122455817 CGATTTCAGCCCTGATGAAT Chr8:122455760..122455779 60.04 45
upstream ENSMUSE00000317164 Chr8:122460431..122460488 TCCCTCCATACAGTGGGACT Chr8:122460432..122460451 59.38 55

*** Putative Vector Insertion (Chr 8: 122460489 - 122465012) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678732 Chr8:122465010..122466038 CCCCTCACTAGGTTCGATGA Chr8:122465074..122465093 60.06 55
downstream ENSMUSE00000213445 Chr8:122465013..122466038 CCCGGGGATTCAAGTATTTT Chr8:122465727..122465746 60.01 45
downstream ENSMUSE00000213441 Chr8:122470975..122471066 TTGCAATGACACTGGCTTATG Chr8:122471023..122471043 59.74 42.86
downstream ENSMUSE00000213436 Chr8:122471601..122471710 GTGATACATCGGAGGGCAAG Chr8:122471642..122471661 60.48 55
downstream ENSMUSE00000213433 Chr8:122472318..122472373 ACTCATTCATGAGCCGAACA Chr8:122472340..122472359 59.24 45
downstream ENSMUSE00000213431 Chr8:122472579..122472682 TTCAGACAGGCTCGACTTGA Chr8:122472682..122472701 59.7 50
downstream ENSMUSE00000213444 Chr8:122474259..122474358 TACTCCTCTGCGTCCTCCTG Chr8:122474287..122474306 60.54 60
downstream ENSMUSE00000213446 Chr8:122475821..122475998 TTCCAGCTCCTCGTCCTCTA Chr8:122475879..122475898 60.09 55
downstream ENSMUSE00000213439 Chr8:122477080..122477245 CCTGGACTGTGCGTATCTTG Chr8:122477183..122477202 59.31 55
downstream ENSMUSE00000213434 Chr8:122478689..122478833 GGCAGCTTCTCCAGAGTCAC Chr8:122478729..122478748 60.14 60
downstream ENSMUSE00000213435 Chr8:122480098..122480163 ATTTTTGATGCCTGGAGAAAGT Chr8:122480124..122480145 59.14 36.36
downstream ENSMUSE00000427692 Chr8:122480483..122481457 AGCGGTTTCCCTCTCGTAAT Chr8:122481194..122481213 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGAAGATGAACTGCCAGA Chr8:122463468..122463488 59.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGAAGATGAACTGCCAGA Chr8:122463468..122463488 59.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031826