Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1283
Trapped Gene
Katnb1 (ENSMUSG00000031787)
Vector Insertion
Chr 8: 97613978 - 97617415
Public Clones DC0817 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212976 (Chr8:97613860..97613977 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGAGGAGCTCATCGTAGC Chr8:97613908..97613927 60.12 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212976 (Chr8:97613860..97613977 +)
Downstram Exon
ENSMUSE00000212977 (Chr8:97617416..97617516 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGAGGAGCTCATCGTAGC Chr8:97613908..97613927 60.12 60 TCACCATAGGGGTGGAAATC Chr8:97617482..97617501 59.6 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606263 Chr8:97605189..97605204 No primer for this exon
upstream ENSMUSE00000446632 Chr8:97606498..97606793 GTCCAAGCCTGACATTCCAT Chr8:97606518..97606537 59.93 50
upstream ENSMUSE00000212971 Chr8:97611188..97611318 GATGACTGCCGAGTCAACCT Chr8:97611268..97611287 60.27 55
upstream ENSMUSE00000212976 Chr8:97613860..97613977 CCTGAGGAGCTCATCGTAGC Chr8:97613908..97613927 60.12 60

*** Putative Vector Insertion (Chr 8: 97613978 - 97617415) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212977 Chr8:97617416..97617516 TCACCATAGGGGTGGAAATC Chr8:97617482..97617501 59.6 50
downstream ENSMUSE00000212974 Chr8:97617814..97617855 TTCCTCCTGATGTCCCAGAG Chr8:97617836..97617855 60.19 55
downstream ENSMUSE00000212981 Chr8:97618380..97618463 CACTGTGTGGTCATCTGCTG Chr8:97618463..97618482 58.82 55
downstream ENSMUSE00000212969 Chr8:97618620..97618735 GGGTGAAACTCCACCACATT Chr8:97618702..97618721 59.68 50
downstream ENSMUSE00000212968 Chr8:97619073..97619144 TCACCACCTGGAACTTCTCC Chr8:97619116..97619135 60.09 55
downstream ENSMUSE00000212982 Chr8:97619252..97619402 CAAGGACCACATCAAAGCAG Chr8:97619358..97619377 59.29 50
downstream ENSMUSE00000212967 Chr8:97619506..97619696 TCGTCAGGTCCACCACATAA Chr8:97619563..97619582 59.96 50
downstream ENSMUSE00000212980 Chr8:97619789..97619919 CATTGTAGTCCTCCGCGTTC Chr8:97619895..97619914 60.66 55
downstream ENSMUSE00000212973 Chr8:97620256..97620306 No primer for this exon
downstream ENSMUSE00000212978 Chr8:97621112..97621188 GGGTTTTGAGACCTCCTTCA Chr8:97621146..97621165 59.11 50
downstream ENSMUSE00000212970 Chr8:97621299..97621418 GAAGTCCGAGGCCTTTAAGC Chr8:97621415..97621434 60.34 55
downstream ENSMUSE00000212984 Chr8:97621515..97621664 TCCATACAGCTCGGACAGTG Chr8:97621650..97621669 59.85 55
downstream ENSMUSE00000212975 Chr8:97621855..97621931 TCAGGAGGTCCACTACCACA Chr8:97621915..97621934 59.1 55
downstream ENSMUSE00000212966 Chr8:97622006..97622080 TGCAGCAGTTTCTCGATCTG Chr8:97622068..97622087 60.29 50
downstream ENSMUSE00000212972 Chr8:97622219..97622335 CTCTCCTCTCGGCTGATGTC Chr8:97622338..97622357 60.1 60
downstream ENSMUSE00000212983 Chr8:97622554..97622956 GCTTAGTCCACAACCGAGGA Chr8:97622846..97622865 60.26 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGGGCCATCTTCAAGGTC Chr8:97613936..97613956 59.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGGGCCATCTTCAAGGTC Chr8:97613936..97613956 59.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031787