Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12835
Trapped Gene
Tsc22d1 (ENSMUSG00000022010)
Vector Insertion
Chr 14: 76905055 - 76905105
Public Clones CMHD-GT_371C2-3 (cmhd)
Private Clones OST471209 (lexicon) OST465881 (lexicon) OST348729 (lexicon) OST180446 (lexicon)
OST168523 (lexicon) OST70925 (lexicon) OST62385 (lexicon) OST60723 (lexicon)
OST6009 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000122900 (Chr14:76905056..76905104 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGGTGCAAGTGTGGTAGC Chr14:76905057..76905076 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000122900 (Chr14:76905056..76905104 +)
Downstram Exon
ENSMUSE00000647340 (Chr14:76905056..76905104 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGGTGCAAGTGTGGTAGC Chr14:76905057..76905076 59.9 55 GCTACCACACTTGCACCAGA Chr14:76905079..76905098 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000685776 Chr14:76814768..76815524 No primer for this exon
upstream ENSMUSE00000555055 Chr14:76815499..76815524 No primer for this exon
upstream ENSMUSE00000403113 Chr14:76815628..76818816 CTGTGGGAGTGGTTTCCAGT Chr14:76817055..76817074 60 55
upstream ENSMUSE00000555054 Chr14:76815724..76816796 ACTAGCGTTACTCCGGCTCA Chr14:76816229..76816248 60.04 55
upstream ENSMUSE00000685775 Chr14:76815724..76816796 ACTAGCGTTACTCCGGCTCA Chr14:76816229..76816248 60.04 55
upstream ENSMUSE00000706438 Chr14:76815953..76818816 CTGTGGGAGTGGTTTCCAGT Chr14:76817055..76817074 60 55
upstream ENSMUSE00000555053 Chr14:76817043..76818816 CTGTGGGAGTGGTTTCCAGT Chr14:76817055..76817074 60 55
upstream ENSMUSE00000685772 Chr14:76888243..76888482 GGTCAGGTTCGAGCATCTGT Chr14:76888293..76888312 60.27 55
upstream ENSMUSE00000685770 Chr14:76903636..76903653 No primer for this exon
upstream ENSMUSE00000122901 Chr14:76904321..76904648 GTAGACCAGTGGCGATGGAT Chr14:76904540..76904559 59.96 55

*** Putative Vector Insertion (Chr 14: 76905055 - 76905105) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122900 Chr14:76905056..76905104 GCTACCACACTTGCACCAGA Chr14:76905079..76905098 59.9 55
downstream ENSMUSE00000647340 Chr14:76905056..76905104 GCTACCACACTTGCACCAGA Chr14:76905079..76905098 59.9 55
downstream ENSMUSE00000685769 Chr14:76906224..76907569 TCGCAAGACTTCAGCAGCTA Chr14:76907377..76907396 60.03 50
downstream ENSMUSE00000685771 Chr14:76906224..76906977 TACTGGGGAGAAAGCGAGAA Chr14:76906643..76906662 59.95 50
downstream ENSMUSE00000685774 Chr14:76906224..76907569 TCGCAAGACTTCAGCAGCTA Chr14:76907377..76907396 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000022010