Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12845
Trapped Gene
4931406C07Rik (ENSMUSG00000031938)
Vector Insertion
Chr 9: 15089436 - 15091799
Public Clones CMHD-GT_438C5-3 (cmhd) CMHD-GT_374E10-3 (cmhd) PSTVUpb18a5 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214836 (Chr9:15091800..15091916 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATGAAGGCTCCCTTGGTT Chr9:15091830..15091849 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214836 (Chr9:15091800..15091916 -)
Downstram Exon
ENSMUSE00000355349 (Chr9:15087783..15089435 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATGAAGGCTCCCTTGGTT Chr9:15091830..15091849 60.07 50 AGCCATCAGCGCTCAGTAAT Chr9:15088019..15088038 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000428179 Chr9:15110481..15110584 TGTGTTCGAACCTGAGTGGA Chr9:15110521..15110540 60.28 50
upstream ENSMUSE00000214833 Chr9:15105811..15105957 TTTCACATGCCAAGTCTGGA Chr9:15105825..15105844 60.24 45
upstream ENSMUSE00000214832 Chr9:15102287..15102385 GTGGTTGACTGCCCAGATTT Chr9:15102319..15102338 59.97 50
upstream ENSMUSE00000214837 Chr9:15099130..15099203 GCATCTGTGGGCAAACTAGAA Chr9:15099183..15099203 60.26 47.62
upstream ENSMUSE00000214838 Chr9:15098876..15098977 AGGTCCATTTCAGACGCTTG Chr9:15098890..15098909 60.26 50
upstream ENSMUSE00000214835 Chr9:15096444..15096620 GCCAATTGTTCAAACAGCAA Chr9:15096596..15096615 59.71 40
upstream ENSMUSE00000273248 Chr9:15095111..15095260 TCATTGAAGTGCAAGCCAAG Chr9:15095240..15095259 59.99 45
upstream ENSMUSE00000214836 Chr9:15091800..15091916 AGATGAAGGCTCCCTTGGTT Chr9:15091830..15091849 60.07 50

*** Putative Vector Insertion (Chr 9: 15089436 - 15091799) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000355349 Chr9:15087783..15089435 AGCCATCAGCGCTCAGTAAT Chr9:15088019..15088038 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGCTCCCTTGGTTTGTCT Chr9:15091823..15091843 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGCTCCCTTGGTTTGTCT Chr9:15091823..15091843 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031938