Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12853
Trapped Gene
Anp32e (ENSMUSG00000015749)
Vector Insertion
Chr 3: 95737982 - 95738698
Public Clones CMHD-GT_371B8-3 (cmhd)
Private Clones OST79927 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000250155 (Chr3:95737832..95737981 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000250155 (Chr3:95737832..95737981 +)
Downstram Exon
ENSMUSE00000176186 (Chr3:95738699..95738821 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000176191 Chr3:95733231..95733573 No primer for this exon
upstream ENSMUSE00000250155 Chr3:95737832..95737981 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95737982 - 95738698) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176186 Chr3:95738699..95738821 No primer for this exon
downstream ENSMUSE00000176192 Chr3:95740947..95741118 No primer for this exon
downstream ENSMUSE00000176188 Chr3:95741805..95741962 No primer for this exon
downstream ENSMUSE00000176187 Chr3:95748230..95748284 No primer for this exon
downstream ENSMUSE00000402384 Chr3:95749103..95749488 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTGAATAAACTCCGGAAGG Chr3:95737963..95737984 60.08 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTGAATAAACTCCGGAAGG Chr3:95737963..95737984 60.08 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015749