Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12869
Trapped Gene
Mrps28 (ENSMUSG00000040269)
Vector Insertion
Chr 3: 8802415 - 8899985
Public Clones (sanger) CMHD-GT_360E11-3 (cmhd) CMHD-GT_441A6-3 (cmhd) CMHD-GT_96H11-3 (cmhd)
CMHD-GT_94A10-3 (cmhd) IST12893H8 (tigm) IST13554G8 (tigm) IST10668H3 (tigm)
Private Clones OST222718 (lexicon) OST29487 (lexicon) OST29358 (lexicon) OST24144 (lexicon)
OST23440 (lexicon) OST23354 (lexicon) OST21462 (lexicon) OST21007 (lexicon)
OST14410 (lexicon) OST13327 (lexicon) OST11417 (lexicon) OST2319 (lexicon)
OST1170 (lexicon)
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311518 (Chr3:8899986..8900167 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGGTGGCAAGTTTCACTG Chr3:8900016..8900035 59.73 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311518 (Chr3:8899986..8900167 -)
Downstram Exon
ENSMUSE00000342738 (Chr3:8802156..8802414 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGGTGGCAAGTTTCACTG Chr3:8900016..8900035 59.73 45 AGCAAGCGCAGTCCATTACT Chr3:8802209..8802228 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000343275 Chr3:8923587..8923823 AGAGCGCTTGTCTTCTCCAA Chr3:8923726..8923745 60.28 50
upstream ENSMUSE00000311518 Chr3:8899986..8900167 TTTGGTGGCAAGTTTCACTG Chr3:8900016..8900035 59.73 45

*** Putative Vector Insertion (Chr 3: 8802415 - 8899985) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000342738 Chr3:8802156..8802414 AGCAAGCGCAGTCCATTACT Chr3:8802209..8802228 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGAGGTCAAGGGGGTTTTT Chr3:8852010..8852030 59.67 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTTTTACGTGACTGGGAAA Chr3:8860921..8860942 58.89 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGACCTAGTCGCCTCCACTT Chr3:8891177..8891197 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAGCATACCCTCGTGACTGG Chr3:8897108..8897128 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040269