Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12870
Trapped Gene
2200001I15Rik (ENSMUSG00000043681)
Vector Insertion
Chr 14: 35166947 - 35168471
Public Clones D107G11 (ggtc) D112D12 (ggtc) D075H11 (ggtc) D112D12 (ggtc) CMHD-GT_258F11-3 (cmhd)
CMHD-GT_423A3-3 (cmhd) CMHD-GT_360D9-3 (cmhd) CMHD-GT_116C7-3 (cmhd) CMHD-GT_495E8-3 (cmhd)
CMHD-GT_308E08-3 (cmhd) CMHD-GT_446F6-3 (cmhd) CMHD-GT_270D7-3 (cmhd) CMHD-GT_298F7-3 (cmhd)
CMHD-GT_336A9-3 (cmhd) CMHD-GT_476E10-3 (cmhd) CMHD-GT_258E11-3 (cmhd) CMHD-GT_158D10-3 (cmhd)
CMHD-GT_329F9-3 (cmhd) CMHD-GT_497G9-3 (cmhd) IST14762D9 (tigm)
Private Clones OST466973 (lexicon) OST465472 (lexicon) OST455241 (lexicon) OST442839 (lexicon)
OST441799 (lexicon) OST439747 (lexicon) OST439322 (lexicon) OST437819 (lexicon)
OST434010 (lexicon) OST431847 (lexicon) OST416751 (lexicon) OST415720 (lexicon)
OST415717 (lexicon) OST412716 (lexicon) OST402326 (lexicon) OST390451 (lexicon)
OST382058 (lexicon) OST377212 (lexicon) OST373278 (lexicon) OST371440 (lexicon)
OST370169 (lexicon) OST368792 (lexicon) OST367522 (lexicon) OST356747 (lexicon)
OST356736 (lexicon) OST341434 (lexicon) OST340266 (lexicon) OST334437 (lexicon)
OST322683 (lexicon) OST322666 (lexicon) OST314863 (lexicon) OST304209 (lexicon)
OST292645 (lexicon) OST289323 (lexicon) OST284118 (lexicon) OST281239 (lexicon)
OST275001 (lexicon) OST271179 (lexicon) OST268149 (lexicon) OST258133 (lexicon)
OST253340 (lexicon) OST240314 (lexicon) OST237494 (lexicon) OST232402 (lexicon)
OST225838 (lexicon) OST224638 (lexicon) OST224633 (lexicon) OST224601 (lexicon)
OST208030 (lexicon) OST206271 (lexicon) OST198785 (lexicon) OST195268 (lexicon)
OST194519 (lexicon) OST194476 (lexicon) OST183048 (lexicon) OST168949 (lexicon)
OST168393 (lexicon) OST165116 (lexicon) OST165044 (lexicon) OST165024 (lexicon)
OST165020 (lexicon) OST149194 (lexicon) OST141361 (lexicon) OST141039 (lexicon)
OST140922 (lexicon) OST137882 (lexicon) OST137434 (lexicon) OST133521 (lexicon)
OST129469 (lexicon) OST126616 (lexicon) OST125567 (lexicon) OST117973 (lexicon)
OST112340 (lexicon) OST101923 (lexicon) OST100686 (lexicon) OST90011 (lexicon)
OST85270 (lexicon) OST85266 (lexicon) OST85262 (lexicon) OST85250 (lexicon)
OST85238 (lexicon) OST81181 (lexicon) OST79509 (lexicon) OST75436 (lexicon)
OST74188 (lexicon) OST68441 (lexicon) OST68440 (lexicon) OST64636 (lexicon)
OST62515 (lexicon) OST57747 (lexicon) OST56276 (lexicon) OST55885 (lexicon)
OST55883 (lexicon) OST54408 (lexicon) OST52063 (lexicon) OST48681 (lexicon)
OST48635 (lexicon) OST48633 (lexicon) OST39414 (lexicon) OST39380 (lexicon)
OST39346 (lexicon) OST37991 (lexicon) OST35542 (lexicon) OST35484 (lexicon)
OST33712 (lexicon) OST33083 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000372767 (Chr14:35168472..35168581 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000372767 (Chr14:35168472..35168581 -)
Downstram Exon
ENSMUSE00000407956 (Chr14:35166884..35166946 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTCACCACCTCTTCCACTG Chr14:35166899..35166918 60.86 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000372767 Chr14:35168472..35168581 No primer for this exon

*** Putative Vector Insertion (Chr 14: 35166947 - 35168471) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000407956 Chr14:35166884..35166946 GCTCACCACCTCTTCCACTG Chr14:35166899..35166918 60.86 60
downstream ENSMUSE00000354129 Chr14:35165073..35165263 GATGGTGTGGGTGACCTTCT Chr14:35165159..35165178 59.82 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACTGAGGGAGCAGGTAAG Chr14:35168465..35168485 59.86 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACTGAGGGAGCAGGTAAG Chr14:35168465..35168485 59.86 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATACGATGCTGGGAGGCTAA Chr14:35168528..35168548 59.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAAAGCACGCTCTTCCAGTC Chr14:35168583..35168603 59.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043681