Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12892
Trapped Gene
Tfpi (ENSMUSG00000027082)
Vector Insertion
Chr 2: 84298291 - 84313855
Public Clones E026C01 (ggtc) E062F12 (ggtc) CMHD-GT_353A7-3 (cmhd) FHCRC-GT-S11-7E1 (fhcrc)
IST14791B3 (tigm) IST14205G11 (tigm)
Private Clones OST420330 (lexicon) OST418349 (lexicon) OST408557 (lexicon) OST403345 (lexicon)
OST393703 (lexicon) OST379797 (lexicon) OST378247 (lexicon) OST339419 (lexicon)
OST319295 (lexicon) OST302179 (lexicon) OST292401 (lexicon) OST288368 (lexicon)
OST281436 (lexicon) OST263126 (lexicon) OST252910 (lexicon) OST251287 (lexicon)
OST250752 (lexicon) OST224005 (lexicon) OST219337 (lexicon) OST195902 (lexicon)
OST186176 (lexicon) OST184784 (lexicon) OST175041 (lexicon) OST168252 (lexicon)
OST128157 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000600985 (Chr2:84313856..84313941 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACCTGTCTCCGGATTTCT Chr2:84313922..84313941 60.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000600985 (Chr2:84313856..84313941 -)
Downstram Exon
ENSMUSE00000237237 (Chr2:84298180..84298290 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACCTGTCTCCGGATTTCT Chr2:84313922..84313941 60.46 55 GAAACTCGGGAACAAGGCTA Chr2:84298191..84298210 59.31 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688739 Chr2:84316898..84316932 No primer for this exon
upstream ENSMUSE00000688736 Chr2:84316848..84316905 AAAGTCCTTCCTCGCTGTGA Chr2:84316869..84316888 59.99 50
upstream ENSMUSE00000688747 Chr2:84316848..84316920 AAAGTCCTTCCTCGCTGTGA Chr2:84316869..84316888 59.99 50
upstream ENSMUSE00000688756 Chr2:84314919..84315437 TTTCTCAGCAGGAAGCCTGT Chr2:84315074..84315093 60.13 50
upstream ENSMUSE00000415207 Chr2:84314100..84314192 CCCGAGCAACCTTTACAGAG Chr2:84314126..84314145 59.87 55
upstream ENSMUSE00000688753 Chr2:84314100..84314342 CCCGAGCAACCTTTACAGAG Chr2:84314126..84314145 59.87 55
upstream ENSMUSE00000237244 Chr2:84313856..84313956 GGACCTGTCTCCGGATTTCT Chr2:84313922..84313941 60.46 55
upstream ENSMUSE00000600985 Chr2:84313856..84313941 GGACCTGTCTCCGGATTTCT Chr2:84313922..84313941 60.46 55

*** Putative Vector Insertion (Chr 2: 84298291 - 84313855) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000237237 Chr2:84298180..84298290 GAAACTCGGGAACAAGGCTA Chr2:84298191..84298210 59.31 50
downstream ENSMUSE00000712250 Chr2:84298180..84298290 GAAACTCGGGAACAAGGCTA Chr2:84298191..84298210 59.31 50
downstream ENSMUSE00000165893 Chr2:84293957..84294154 TTCTCGTTCCCTTCACATCC Chr2:84293979..84293998 60.05 50
downstream ENSMUSE00000165888 Chr2:84292714..84292752 GCTGCCTTCACAGCTGTCTT Chr2:84292703..84292722 60.74 55
downstream ENSMUSE00000237215 Chr2:84284897..84285073 CACGAATCGTTCACACTGCT Chr2:84284948..84284967 59.9 50
downstream ENSMUSE00000165889 Chr2:84284167..84284295 TGGGGAACCACGATGTTATT Chr2:84284171..84284190 60.05 45
downstream ENSMUSE00000688761 Chr2:84284167..84284277 TGGGGAACCACGATGTTATT Chr2:84284171..84284190 60.05 45
downstream ENSMUSE00000688738 Chr2:84283360..84283469 ACGGAACTCAGAAAGCCTTG Chr2:84283378..84283397 59.47 50
downstream ENSMUSE00000688748 Chr2:84283027..84283082 No primer for this exon
downstream ENSMUSE00000565912 Chr2:84280297..84283082 AACCCATCGGTGATGACATT Chr2:84282676..84282695 60.06 45
downstream ENSMUSE00000688735 Chr2:84280297..84283469 AACCCATCGGTGATGACATT Chr2:84282676..84282695 60.06 45
downstream ENSMUSE00000165890 Chr2:84274399..84274578 TCCCCCACATCCAGTGTAGT Chr2:84274429..84274448 60.24 55
downstream ENSMUSE00000377228 Chr2:84273014..84273341 TGGTCACCAATGGAAACAAG Chr2:84273114..84273133 59.39 45
downstream ENSMUSE00000688760 Chr2:84273012..84273341 TGGTCACCAATGGAAACAAG Chr2:84273114..84273133 59.39 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACACGTAAAGATGCCAAAT Chr2:84298808..84298829 60.02 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACACGTAAAGATGCCAAAT Chr2:84298808..84298829 60.02 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGGGGGTTTAATGGGGTAA Chr2:84298888..84298908 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCTGGGAAAAGCAGCACAC Chr2:84298909..84298929 61.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027082