Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12899
Trapped Gene
Gins1 (ENSMUSG00000027454)
Vector Insertion
Chr 2: 150743696 - 150751617
Public Clones CMHD-GT_339H7-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000286041 (Chr2:150743605..150743695 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGATTCCACATGTCTGCTG Chr2:150743671..150743690 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000286041 (Chr2:150743605..150743695 +)
Downstram Exon
ENSMUSE00000385793 (Chr2:150751618..150751734 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGATTCCACATGTCTGCTG Chr2:150743671..150743690 59.71 50 GTGTGATGTCCAAGCCTTCA Chr2:150751702..150751721 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000169711 Chr2:150735337..150735529 AGCTTGTCCGCGAGTTACAC Chr2:150735477..150735496 60.46 55
upstream ENSMUSE00000169710 Chr2:150738517..150738581 CGGACTCAGACAAGTTCTGGA Chr2:150738522..150738542 60.43 52.38
upstream ENSMUSE00000169709 Chr2:150741872..150741970 TAGACGCTGCACGATAGCAT Chr2:150741947..150741966 59.62 50
upstream ENSMUSE00000286041 Chr2:150743605..150743695 ACGATTCCACATGTCTGCTG Chr2:150743671..150743690 59.71 50

*** Putative Vector Insertion (Chr 2: 150743696 - 150751617) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000385793 Chr2:150751618..150751734 GTGTGATGTCCAAGCCTTCA Chr2:150751702..150751721 59.68 50
downstream ENSMUSE00000595309 Chr2:150753778..150753852 AGCAGGACTGAAGTGCCATC Chr2:150753839..150753858 60.42 55
downstream ENSMUSE00000595308 Chr2:150756577..150757014 TCCAGTGAGGACGTTTCCTT Chr2:150756718..150756737 59.7 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr2:150743744..150743764 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCAAACGTGACTGGGAAAA Chr2:150743741..150743761 58.05 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027454