Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12904
Trapped Gene
Rbm4 (ENSMUSG00000056951)
Vector Insertion
Chr 19: 4785568 - 4787360
Public Clones CMHD-GT_339E9-3 (cmhd) PSTVUpb7e12 (vanderbilt) PSTVUpb6h3R1 (vanderbilt) PSTVUb3p3h8fs (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000250822 (Chr19:4787361..4788042 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAATATGGAGCAGTGCGTA Chr19:4787860..4787879 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000250822 (Chr19:4787361..4788042 -)
Downstram Exon
ENSMUSE00000622604 (Chr19:4784299..4785567 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAATATGGAGCAGTGCGTA Chr19:4787860..4787879 59.86 50 CCCAAATCCAATACCCACTG Chr19:4785236..4785255 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000250866 Chr19:4793672..4793877 GCGGTGAGATACTCCACGTT Chr19:4793799..4793818 60.14 55
upstream ENSMUSE00000250851 Chr19:4792398..4792820 TGCACGGAGTGAACATCAAT Chr19:4792612..4792631 60.12 45
upstream ENSMUSE00000250822 Chr19:4787361..4788042 GCAATATGGAGCAGTGCGTA Chr19:4787860..4787879 59.86 50

*** Putative Vector Insertion (Chr 19: 4785568 - 4787360) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000622604 Chr19:4784299..4785567 CCCAAATCCAATACCCACTG Chr19:4785236..4785255 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCCCTCCTGTGGCCTAATC Chr19:4787304..4787324 60.29 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTCACCTGTTGGTTTTGC Chr19:4787325..4787345 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAGCAACCCTTCTTGCGTCT Chr19:4788052..4788072 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TAGCAACCCTTCTTGCGTCT Chr19:4788052..4788072 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056951