Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12911
Trapped Gene
Taf5 (ENSMUSG00000025049)
Vector Insertion
Chr 19: 47142817 - 47145470
Public Clones CMHD-GT_418G4-3 (cmhd) CMHD-GT_418G12-3 (cmhd) CMHD-GT_348E5-3 (cmhd) CMHD-GT_357A1-3 (cmhd)
Private Clones OST422567 (lexicon) OST300492 (lexicon) OST100626 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000418957 (Chr19:47142236..47142816 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000418957 (Chr19:47142236..47142816 +)
Downstram Exon
ENSMUSE00000334354 (Chr19:47145471..47145708 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACTGACGTCTGGCTGGTCTT Chr19:47145511..47145530 59.91 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418957 Chr19:47142236..47142816 No primer for this exon

*** Putative Vector Insertion (Chr 19: 47142817 - 47145470) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000334354 Chr19:47145471..47145708 ACTGACGTCTGGCTGGTCTT Chr19:47145511..47145530 59.91 55
downstream ENSMUSE00000375459 Chr19:47149303..47149618 CTTCGATTTGTTCGCCTCTC Chr19:47149621..47149640 59.96 50
downstream ENSMUSE00000147573 Chr19:47150226..47150389 ATCATCCAAAGGCACCTCAA Chr19:47150279..47150298 60.46 45
downstream ENSMUSE00000147568 Chr19:47150487..47150622 GCGCACTCGTTTGGTAGTTT Chr19:47150568..47150587 60.31 50
downstream ENSMUSE00000147566 Chr19:47151764..47151884 GGGGTCACAGACCACACTCT Chr19:47151855..47151874 60.01 60
downstream ENSMUSE00000147570 Chr19:47153258..47153387 TGAAGCTGGCTCCATAGACA Chr19:47153380..47153399 59.55 50
downstream ENSMUSE00000147578 Chr19:47155031..47155195 GGCCTCCTGACACGAAATAA Chr19:47155182..47155201 60.07 50
downstream ENSMUSE00000147575 Chr19:47156299..47156476 ACCATTGAGGACATCCCAGA Chr19:47156449..47156468 60.33 50
downstream ENSMUSE00000147569 Chr19:47156634..47156811 TAGCCAGGAATCTCCCATTG Chr19:47156685..47156704 60.03 50
downstream ENSMUSE00000147572 Chr19:47156917..47157467 GTTGGCTTATTGCGGACTGT Chr19:47157143..47157162 60.14 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000025049