Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12927
Trapped Gene
Tnfsf12 (ENSMUSG00000018752)
Vector Insertion
Chr 11: 69498035 - 69498161
Public Clones CMHD-GT_352F11-3 (cmhd) IST10682E11 (tigm) IST11892E11 (tigm) IST13436B9 (tigm)
Private Clones OST48628 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111681 (Chr11:69498162..69498240 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111681 (Chr11:69498162..69498240 -)
Downstram Exon
ENSMUSE00000111685 (Chr11:69497987..69498034 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479377 Chr11:69509098..69509600 No primer for this exon
upstream ENSMUSE00000662017 Chr11:69509098..69509311 No primer for this exon
upstream ENSMUSE00000677497 Chr11:69509098..69509499 No primer for this exon
upstream ENSMUSE00000329192 Chr11:69508896..69508946 No primer for this exon
upstream ENSMUSE00000662016 Chr11:69508896..69508943 No primer for this exon
upstream ENSMUSE00000111687 Chr11:69508252..69508327 No primer for this exon
upstream ENSMUSE00000111686 Chr11:69507123..69507176 No primer for this exon
upstream ENSMUSE00000111689 Chr11:69507008..69507043 No primer for this exon
upstream ENSMUSE00000111691 Chr11:69500754..69500878 No primer for this exon
upstream ENSMUSE00000651691 Chr11:69500459..69500593 No primer for this exon
upstream ENSMUSE00000662015 Chr11:69500342..69500593 No primer for this exon
upstream ENSMUSE00000578728 Chr11:69498531..69498761 No primer for this exon
upstream ENSMUSE00000651690 Chr11:69498531..69498632 No primer for this exon
upstream ENSMUSE00000677468 Chr11:69498531..69499056 No primer for this exon
upstream ENSMUSE00000111681 Chr11:69498162..69498240 No primer for this exon

*** Putative Vector Insertion (Chr 11: 69498035 - 69498161) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111685 Chr11:69497987..69498034 No primer for this exon
downstream ENSMUSE00000111682 Chr11:69497720..69497838 No primer for this exon
downstream ENSMUSE00000651682 Chr11:69497720..69497835 No primer for this exon
downstream ENSMUSE00000111680 Chr11:69497356..69497494 No primer for this exon
downstream ENSMUSE00000677472 Chr11:69496733..69496846 No primer for this exon
downstream ENSMUSE00000651681 Chr11:69496348..69496846 No primer for this exon
downstream ENSMUSE00000500568 Chr11:69496079..69496846 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAACTCTGGCCCTCTTTCA Chr11:69498246..69498266 60.37 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACTCTGGCCCTCTTTCA Chr11:69498246..69498266 60.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018752