Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12953
Trapped Gene
Adprh (ENSMUSG00000002844)
Vector Insertion
Chr 16: 38450564 - 38452608
Public Clones 5SE287A02 (ggtc) 3SE287A02 (ggtc) D185B08 (ggtc) 5SE287B02 (ggtc)
CMHD-GT_378H4-3 (cmhd) CMHD-GT_309B05-3 (cmhd) (cmhd) CMHD-GT_350D12-3 (cmhd)
IST14363H9 (tigm) IST12905F6 (tigm) IST14951D6 (tigm) IST12233G1 (tigm)
IST12979G4 (tigm) IST12233G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000368965 (Chr16:38452609..38452738 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000368965 (Chr16:38452609..38452738 -)
Downstram Exon
ENSMUSE00000319529 (Chr16:38450209..38450563 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000368965 Chr16:38452609..38452738 No primer for this exon

*** Putative Vector Insertion (Chr 16: 38450564 - 38452608) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000319529 Chr16:38450209..38450563 No primer for this exon
downstream ENSMUSE00000130545 Chr16:38447328..38447688 No primer for this exon
downstream ENSMUSE00000412489 Chr16:38445488..38446184 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGAGCCACTCTCCTCTTAC Chr16:38452571..38452591 59.04 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAGCCACTCTCCTCTTAC Chr16:38452571..38452591 59.04 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002844