Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12955
Trapped Gene
Fnbp1 (ENSMUSG00000075415)
Vector Insertion
Chr 2: 30910947 - 30911095
Public Clones CMHD-GT_341E7-3 (cmhd) CMHD-GT_349B9-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000281923 (Chr2:30910948..30911094 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGACGTACGCAGAGGTG Chr2:30911026..30911045 60.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000281923 (Chr2:30910948..30911094 -)
Downstram Exon
ENSMUSE00000696119 (Chr2:30910948..30911094 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGACGTACGCAGAGGTG Chr2:30911026..30911045 60.05 55 CACCTCTGCGTACGTCTTCA Chr2:30911004..30911023 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479781 Chr2:30997299..30997526 CTTTCCGCATTCACAAGGTT Chr2:30997383..30997402 60.11 45
upstream ENSMUSE00000662797 Chr2:30997299..30997528 CTTTCCGCATTCACAAGGTT Chr2:30997383..30997402 60.11 45
upstream ENSMUSE00000696139 Chr2:30997299..30997322 No primer for this exon
upstream ENSMUSE00000696122 Chr2:30971745..30971807 ATGGAAGATGGCCTGATGAA Chr2:30971788..30971807 60.43 45
upstream ENSMUSE00000696128 Chr2:30965016..30965028 No primer for this exon
upstream ENSMUSE00000696143 Chr2:30965016..30965029 No primer for this exon
upstream ENSMUSE00000696142 Chr2:30961422..30961429 No primer for this exon
upstream ENSMUSE00000281967 Chr2:30960762..30960877 CAAGGAGAGGACGGAGATTG Chr2:30960787..30960806 59.8 55
upstream ENSMUSE00000163540 Chr2:30952614..30952670 AACTCGAAGGAAGAGGAGGA Chr2:30952620..30952639 58.05 50
upstream ENSMUSE00000163542 Chr2:30951547..30951694 CAGCACGAGGTCATCTCTGA Chr2:30951617..30951636 60.14 55
upstream ENSMUSE00000163538 Chr2:30939543..30939605 GGCTCAGCAGCACATAGAAA Chr2:30939566..30939585 59.18 50
upstream ENSMUSE00000163541 Chr2:30938494..30938598 GTTTGAGCGGGACTGTAAGG Chr2:30938568..30938587 59.73 55
upstream ENSMUSE00000717061 Chr2:30914409..30914537 TACCCACATCCCCAACATCT Chr2:30914414..30914433 60.05 50
upstream ENSMUSE00000722142 Chr2:30914409..30914537 TACCCACATCCCCAACATCT Chr2:30914414..30914433 60.05 50
upstream ENSMUSE00000696123 Chr2:30914128..30914133 No primer for this exon
upstream ENSMUSE00000281923 Chr2:30910948..30911094 TGAAGACGTACGCAGAGGTG Chr2:30911026..30911045 60.05 55
upstream ENSMUSE00000696119 Chr2:30910948..30911094 TGAAGACGTACGCAGAGGTG Chr2:30911026..30911045 60.05 55

*** Putative Vector Insertion (Chr 2: 30910947 - 30911095) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568127 Chr2:30909544..30909738 GACACTGTGCGTTTCATTGG Chr2:30909619..30909638 60.16 50
downstream ENSMUSE00000696126 Chr2:30909511..30909738 GACACTGTGCGTTTCATTGG Chr2:30909619..30909638 60.16 50
downstream ENSMUSE00000662796 Chr2:30908755..30909738 TATCGATGCCACGGTACAAA Chr2:30908785..30908804 59.95 45
downstream ENSMUSE00000506828 Chr2:30908505..30908600 AGCAGTGGATTTTGGGTTTG Chr2:30908503..30908522 59.97 45
downstream ENSMUSE00000568126 Chr2:30908505..30908687 CTTTAGGCTCCGGAAGCAGT Chr2:30908489..30908508 60.88 55
downstream ENSMUSE00000696157 Chr2:30908505..30908657 AGCAGTGGATTTTGGGTTTG Chr2:30908503..30908522 59.97 45
downstream ENSMUSE00000696148 Chr2:30900402..30900416 No primer for this exon
downstream ENSMUSE00000604325 Chr2:30895925..30896034 CTCTGGTCCGTCTCCTTCTG Chr2:30895903..30895922 59.98 60
downstream ENSMUSE00000604324 Chr2:30892676..30892808 GGTGACTTCGGTGAGCTTCT Chr2:30892696..30892715 59.46 55
downstream ENSMUSE00000604323 Chr2:30892062..30892183 GTGACCGTCTGGTGTGTCTG Chr2:30892064..30892083 60.21 60
downstream ENSMUSE00000604322 Chr2:30891638..30891774 ATGTGTAGAGGGCCTTGCAG Chr2:30891622..30891641 60.28 55
downstream ENSMUSE00000568116 Chr2:30888550..30888708 CGTAGGAAGTGGGGACGTAA Chr2:30888558..30888577 59.99 55
downstream ENSMUSE00000696131 Chr2:30888530..30888708 CGTAGGAAGTGGGGACGTAA Chr2:30888558..30888577 59.99 55
downstream ENSMUSE00000335812 Chr2:30888523..30888708 CGTAGGAAGTGGGGACGTAA Chr2:30888558..30888577 59.99 55
downstream ENSMUSE00000696134 Chr2:30888519..30888708 CGTAGGAAGTGGGGACGTAA Chr2:30888558..30888577 59.99 55
downstream ENSMUSE00000696146 Chr2:30881727..30884403 GGAGAACAGGATCCGATGAA Chr2:30883457..30883476 60.01 50
downstream ENSMUSE00000696138 Chr2:30881726..30888708 AGCGGTAAATGTCACGTTCC Chr2:30882287..30882306 60 50
downstream ENSMUSE00000696149 Chr2:30881726..30884403 GGAGAACAGGATCCGATGAA Chr2:30883457..30883476 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGTGCGTATTGGGGAGTC Chr2:30911046..30911066 59.82 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTGTGCGTATTGGGGAGTC Chr2:30911046..30911066 59.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075415