Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12956
Trapped Gene
Ppil1 (ENSMUSG00000024007)
Vector Insertion
Chr 17: 29398837 - 29400816
Public Clones (sanger) (sanger) D183E02 (ggtc) H008B11 (ggtc) D017B02 (ggtc)
E037E08 (ggtc) D183E02 (ggtc) E038G08 (ggtc) D183F02 (ggtc) D017B02 (ggtc)
E037E08 (ggtc) CMHD-GT_351F1-3 (cmhd) CMHD-GT_496E6-3 (cmhd) PST19112-NR (escells)
PST3171-NR (escells) PST20318-NR (escells)
Private Clones OST463572 (lexicon) OST463522 (lexicon) OST448862 (lexicon) OST442879 (lexicon)
OST436072 (lexicon) OST380370 (lexicon) OST351443 (lexicon) OST319010 (lexicon)
OST312696 (lexicon) OST307753 (lexicon) OST300522 (lexicon) OST299719 (lexicon)
OST283747 (lexicon) OST281689 (lexicon) OST279535 (lexicon) OST272944 (lexicon)
OST261589 (lexicon) OST259487 (lexicon) OST251122 (lexicon) OST249436 (lexicon)
OST234568 (lexicon) OST222100 (lexicon) OST220490 (lexicon) OST219293 (lexicon)
OST218412 (lexicon) OST206889 (lexicon) OST198777 (lexicon) OST174843 (lexicon)
OST166930 (lexicon) OST153482 (lexicon) OST148726 (lexicon) OST143957 (lexicon)
OST142543 (lexicon) OST142148 (lexicon) OST139885 (lexicon) OST136734 (lexicon)
OST136729 (lexicon) OST134846 (lexicon) OST127435 (lexicon) OST127392 (lexicon)
OST123967 (lexicon) OST108784 (lexicon) OST102250 (lexicon) OST56977 (lexicon)
OST47981 (lexicon) OST41174 (lexicon) OST37531 (lexicon) OST33329 (lexicon)
OST30394 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137197 (Chr17:29400817..29400883 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCAACGTCTACCTGGAGACTA Chr17:29400818..29400839 60.54 54.54 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137197 (Chr17:29400817..29400883 -)
Downstram Exon
ENSMUSE00000137198 (Chr17:29398682..29398836 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCAACGTCTACCTGGAGACTA Chr17:29400818..29400839 60.54 54.54 TGGAACTTGGTGCCATTGTA Chr17:29398710..29398729 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000137197 Chr17:29400817..29400883 CCCAACGTCTACCTGGAGACTA Chr17:29400818..29400839 60.54 54.54

*** Putative Vector Insertion (Chr 17: 29398837 - 29400816) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137198 Chr17:29398682..29398836 TGGAACTTGGTGCCATTGTA Chr17:29398710..29398729 59.96 45
downstream ENSMUSE00000236458 Chr17:29389195..29389263 CATAAATAGATGCGCCACCTC Chr17:29389218..29389238 59.58 47.62
downstream ENSMUSE00000236429 Chr17:29387775..29388670 ACAGCATCCCACCTATCCAG Chr17:29388416..29388435 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAGGTGAGGGTTGGAGGTG Chr17:29400799..29400819 59.57 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGGTGAGGGTTGGAGGTG Chr17:29400799..29400819 59.57 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTCCGCCGGAAGTAGTGAT Chr17:29400900..29400920 61.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACTCCGCCGGAAGTAGTGAT Chr17:29400900..29400920 61.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024007