Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12968
Trapped Gene
Zfp13 (ENSMUSG00000062012)
Vector Insertion
Chr 17: 23722542 - 23736118
Public Clones (ggtc) D072B06 (ggtc) CMHD-GT_352B1-3 (cmhd) CMHD-GT_476G1-3 (cmhd) CMHD-GT_475G1-3 (cmhd)
PST6388-NL (escells) IST12487F1 (tigm) IST12395G6 (tigm) IST10382D10 (tigm)
IST14029E11 (tigm) IST12487F1 (tigm) IST10076A3BBF2 (tigm) IST14350F11 (tigm)
IST14115F12 (tigm) IST10884C11 (tigm) IST11411F11 (tigm) IST12805B1 (tigm)
IST12660F1 (tigm) IST14350F11 (tigm) IST14153G1 (tigm) IST10265H3 (tigm)
IST11025E7 (tigm) IST10392H2 (tigm) IST12395G6 (tigm) IST13848C11 (tigm)
IST13337B1 (tigm) IST13013C3 (tigm) IST13798D12 (tigm) IST14636H8 (tigm)
IST13578F10 (tigm) IST10090E10 (tigm) IST14457H8 (tigm) IST13798D12 (tigm)
IST15005B9 (tigm) IST14866E10 (tigm) IST13780A12 (tigm) IST14886A12 (tigm)
IST14153G1 (tigm) IST15043B12 (tigm) IST14115F12 (tigm) IST14274E9 (tigm)
IST10265H3 (tigm) IST10068E12 (tigm) IST10382D10 (tigm) IST11788F5 (tigm)
Private Clones OST449974 (lexicon) OST437614 (lexicon) OST418959 (lexicon) OST416502 (lexicon)
OST345033 (lexicon) OST333742 (lexicon) OST319019 (lexicon) OST295672 (lexicon)
OST292513 (lexicon) OST286257 (lexicon) OST285883 (lexicon) OST282033 (lexicon)
OST281512 (lexicon) OST268856 (lexicon) OST261973 (lexicon) OST240409 (lexicon)
OST204064 (lexicon) OST148798 (lexicon) OST148627 (lexicon) OST147304 (lexicon)
OST132083 (lexicon) OST131024 (lexicon) OST107071 (lexicon) OST79587 (lexicon)
OST68218 (lexicon) OST67562 (lexicon) OST52851 (lexicon) OST41035 (lexicon)
OST36981 (lexicon) OST34139 (lexicon) OST30035 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000347574 (Chr17:23736119..23736454 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGCAGAGCACCTCAACTT Chr17:23736186..23736205 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000347574 (Chr17:23736119..23736454 -)
Downstram Exon
ENSMUSE00000383128 (Chr17:23722405..23722541 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGCAGAGCACCTCAACTT Chr17:23736186..23736205 59.87 50 GCAAATGGTTCTTTCCCTTG Chr17:23722466..23722485 59.55 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000347574 Chr17:23736119..23736454 ATGGCAGAGCACCTCAACTT Chr17:23736186..23736205 59.87 50

*** Putative Vector Insertion (Chr 17: 23722542 - 23736118) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383128 Chr17:23722405..23722541 GCAAATGGTTCTTTCCCTTG Chr17:23722466..23722485 59.55 45
downstream ENSMUSE00000612751 Chr17:23718045..23718237 TCCTCCTGTCCAGAGAGCAT Chr17:23718166..23718185 59.94 55
downstream ENSMUSE00000703191 Chr17:23718024..23718237 TCCTCCTGTCCAGAGAGCAT Chr17:23718166..23718185 59.94 55
downstream ENSMUSE00000379212 Chr17:23717738..23717829 CCATCTTTCGCTCTCTGGTC Chr17:23717745..23717764 59.95 55
downstream ENSMUSE00000335258 Chr17:23717079..23717199 GCCACATCCTCAAAGGTCAC Chr17:23717152..23717171 60.52 55
downstream ENSMUSE00000496162 Chr17:23712819..23714078 TCATCCCACTGGCTAAGACC Chr17:23712904..23712923 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGCAAGTGTGCGTAATCG Chr17:23730061..23730081 61.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACGCCTTACTTCCCCTACT Chr17:23730102..23730122 58.34 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATCGCCTTGCAGCACATC Chr17:23730384..23730404 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACCATGCGTGACTGGGAAAA Chr17:23730390..23730410 63.75 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062012