Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12976
Trapped Gene
Car14 (ENSMUSG00000038526)
Vector Insertion
Chr 3: 95706055 - 95708242
Public Clones CMHD-GT_353D3-3 (cmhd)
Private Clones OST403484 (lexicon) OST282004 (lexicon) OST160955 (lexicon) OST113336 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000399348 (Chr3:95708243..95708562 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATACGGAGAGGGCAGAGAG Chr3:95708510..95708529 59.97 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000399348 (Chr3:95708243..95708562 -)
Downstram Exon
ENSMUSE00000509998 (Chr3:95706034..95706054 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATACGGAGAGGGCAGAGAG Chr3:95708510..95708529 59.97 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000399348 Chr3:95708243..95708562 CATACGGAGAGGGCAGAGAG Chr3:95708510..95708529 59.97 60

*** Putative Vector Insertion (Chr 3: 95706055 - 95708242) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000509998 Chr3:95706034..95706054 No primer for this exon
downstream ENSMUSE00000498948 Chr3:95705016..95705195 GCAGATCGGGGTCAAATATC Chr3:95705066..95705085 59.35 50
downstream ENSMUSE00000499817 Chr3:95704166..95704308 CTGTGTATTTTCGGGGCAGT Chr3:95704230..95704249 59.99 50
downstream ENSMUSE00000512292 Chr3:95703854..95703949 GCTTCTGAGCTGCCTCACTC Chr3:95703867..95703886 60.44 60
downstream ENSMUSE00000513226 Chr3:95703663..95703729 No primer for this exon
downstream ENSMUSE00000471391 Chr3:95703354..95703511 TGTGAGTGAGCCGTTGTAGC Chr3:95703401..95703420 60.06 55
downstream ENSMUSE00000472408 Chr3:95703147..95703267 AGGCTGGGGGACTCTGTAGT Chr3:95703162..95703181 60.13 60
downstream ENSMUSE00000468151 Chr3:95702900..95702920 No primer for this exon
downstream ENSMUSE00000469190 Chr3:95702724..95702808 AGCCAAGATTCCCACACCTA Chr3:95702752..95702771 59.55 50
downstream ENSMUSE00000475522 Chr3:95701723..95702135 AGAGTTCACGCCTCTGTGGT Chr3:95702042..95702061 59.91 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTAATGTCCACCCGTAGC Chr3:95708202..95708222 61.05 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGCTAATGTCCACCCGTA Chr3:95708204..95708224 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038526