Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12979
Trapped Gene
Rps24 (ENSMUSG00000025290)
Vector Insertion
Chr 14: 25309981 - 25310971
Public Clones (sanger) 3SP105E11 (ggtc) CMHD-GT_305B09-3 (cmhd) CMHD-GT_354A2-3 (cmhd)
PST22623-NR (escells)
Private Clones OST419752 (lexicon) OST357233 (lexicon) OST284332 (lexicon) OST277244 (lexicon)
OST275574 (lexicon) OST130250 (lexicon) OST124301 (lexicon) OST32541 (lexicon)
OST5616 (lexicon) OST557 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691481 (Chr14:25309940..25309980 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTTTCCTCCTCTCCAGCTC Chr14:25309941..25309961 60.08 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691481 (Chr14:25309940..25309980 +)
Downstram Exon
ENSMUSE00000619464 (Chr14:25310972..25311037 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTTTCCTCCTCTCCAGCTC Chr14:25309941..25309961 60.08 52.38 CTCTGAAGCAGACGGTTGGT Chr14:25311030..25311049 60.44 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691481 Chr14:25309940..25309980 TCTTTTCCTCCTCTCCAGCTC Chr14:25309941..25309961 60.08 52.38

*** Putative Vector Insertion (Chr 14: 25309981 - 25310971) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000619464 Chr14:25310972..25311037 CTCTGAAGCAGACGGTTGGT Chr14:25311030..25311049 60.44 55
downstream ENSMUSE00000619463 Chr14:25311129..25311338 TCCCGAATTTCTGTCTTTGG Chr14:25311187..25311206 60.04 45
downstream ENSMUSE00000619462 Chr14:25312605..25312715 GCTGTTTTCGGGAGGTCTTT Chr14:25312647..25312666 60.61 50
downstream ENSMUSE00000691466 Chr14:25312839..25312841 No primer for this exon
downstream ENSMUSE00000691469 Chr14:25314652..25314671 No primer for this exon
downstream ENSMUSE00000650494 Chr14:25314997..25315067 AAACATCAAGTCACCGCAGA Chr14:25315032..25315051 59.29 45
downstream ENSMUSE00000691468 Chr14:25314997..25315067 AAACATCAAGTCACCGCAGA Chr14:25315032..25315051 59.29 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATCATGGTGAGTCTCCT Chr14:25309973..25309993 60.08 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCATCATGGTGAGTCTCCT Chr14:25309973..25309993 60.08 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025290