Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12980
Trapped Gene
Chchd5 (ENSMUSG00000037938)
Vector Insertion
Chr 2: 128956303 - 128959010
Public Clones (sanger) (sanger) (sanger) (ggtc) (ggtc) CMHD-GT_353F4-3 (cmhd)
CMHD-GT_406F5-3 (cmhd) CMHD-GT_162F8-3 (cmhd) CMHD-GT_447D8-3 (cmhd) CMHD-GT_406E5-3 (cmhd)
IST14485A6 (tigm) IST14594E3 (tigm) IST14507H8 (tigm)
Private Clones OST411656 (lexicon) OST331774 (lexicon) OST210671 (lexicon) OST197093 (lexicon)
OST167816 (lexicon) OST138363 (lexicon) OST107471 (lexicon) OST37840 (lexicon)
OST35015 (lexicon) OST16175 (lexicon) OST11403 (lexicon) OST1603 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000396198 (Chr2:128956137..128956302 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGTTCACCCACAACTGGA Chr2:128956280..128956299 59.56 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000396198 (Chr2:128956137..128956302 +)
Downstram Exon
ENSMUSE00000366170 (Chr2:128959011..128959190 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGTTCACCCACAACTGGA Chr2:128956280..128956299 59.56 50 ATCAAGTGGGACGGTCAATC Chr2:128959087..128959106 59.79 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000263102 Chr2:128955545..128955593 CGGGTCTCTTCTCCCTGACT Chr2:128955547..128955566 60.78 60
upstream ENSMUSE00000358210 Chr2:128955914..128956054 AGAGTCGTGGCATCGAGATT Chr2:128955992..128956011 59.83 50
upstream ENSMUSE00000396198 Chr2:128956137..128956302 CAAGTTCACCCACAACTGGA Chr2:128956280..128956299 59.56 50

*** Putative Vector Insertion (Chr 2: 128956303 - 128959010) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000366170 Chr2:128959011..128959190 ATCAAGTGGGACGGTCAATC Chr2:128959087..128959106 59.79 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTCATAATCGCCTTGCAG Chr2:128956348..128956368 60.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGTTCACCCACAACTGGA Chr2:128956281..128956301 59.56 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037938