Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12981
Trapped Gene
Gm1631 (ENSMUSG00000064263)
Vector Insertion
Chr 2: 71561554 - 71568406
Public Clones CMHD-GT_353D2-3 (cmhd)
Private Clones OST464659 (lexicon) OST441846 (lexicon) OST313624 (lexicon) OST285764 (lexicon)
OST215782 (lexicon) OST182932 (lexicon) OST127641 (lexicon) OST80651 (lexicon)
OST65356 (lexicon) OST64700 (lexicon) OST59920 (lexicon) OST59919 (lexicon)
OST15445 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503171 (Chr2:71561347..71561553 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGCTCAAGCAGCAATCAG Chr2:71561353..71561372 59.89 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503171 (Chr2:71561347..71561553 +)
Downstram Exon
ENSMUSE00000690501 (Chr2:71568407..71568489 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGCTCAAGCAGCAATCAG Chr2:71561353..71561372 59.89 50 TCCAACACCAGGCTAGAACA Chr2:71568474..71568493 59.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690502 Chr2:71557446..71557565 AGTGCATGGAGAGGAACCAG Chr2:71557533..71557552 60.26 55
upstream ENSMUSE00000492955 Chr2:71557474..71557565 AGTGCATGGAGAGGAACCAG Chr2:71557533..71557552 60.26 55
upstream ENSMUSE00000503171 Chr2:71561347..71561553 CAAGCTCAAGCAGCAATCAG Chr2:71561353..71561372 59.89 50

*** Putative Vector Insertion (Chr 2: 71561554 - 71568406) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000506080 Chr2:71568407..71568490 TCCAACACCAGGCTAGAACA Chr2:71568474..71568493 59.29 50
downstream ENSMUSE00000690501 Chr2:71568407..71568489 TCCAACACCAGGCTAGAACA Chr2:71568474..71568493 59.29 50
downstream ENSMUSE00000690500 Chr2:71568766..71569023 TTGCATATTCCACTCGCTTG Chr2:71568854..71568873 59.83 45
downstream ENSMUSE00000690503 Chr2:71568767..71568955 TTGCATATTCCACTCGCTTG Chr2:71568854..71568873 59.83 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGACAAAGCTGCAGCCAAC Chr2:71564507..71564527 60.58 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGACAAAGCTGCAGCCAAC Chr2:71564507..71564527 60.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064263