Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12986
Trapped Gene
Ccdc57 (ENSMUSG00000048445)
Vector Insertion
Chr 11: 120688239 - 120721714
Public Clones CMHD-GT_171D6-3 (cmhd) CMHD-GT_120H2-3 (cmhd) CMHD-GT_414E10-3 (cmhd) CMHD-GT_533F12-3 (cmhd)
CMHD-GT_489G7-3 (cmhd) CMHD-GT_167G3-3 (cmhd) CMHD-GT_394G8-3 (cmhd) CMHD-GT_542C4-5S (cmhd)
CMHD-GT_441H4-3 (cmhd) CMHD-GT_358D2-3 (cmhd) CMHD-GT_151C4-3 (cmhd) CMHD-GT_439F6-3 (cmhd)
CMHD-GT_376E7-3 (cmhd) CMHD-GT_542C4-3S (cmhd) CMHD-GT_459H10-3 (cmhd) CMHD-GT_152A11-3 (cmhd)
CMHD-GT_103B2-3 (cmhd) CMHD-GT_405A3-3 (cmhd) CMHD-GT_543D7-3 (cmhd) CMHD-GT_451G3-3 (cmhd)
CMHD-GT_156F1-3 (cmhd) CMHD-GT_391G3-3 (cmhd) CMHD-GT_492D2-3 (cmhd) CMHD-GT_358A3-3 (cmhd)
CMHD-GT_131C9-3 (cmhd) CMHD-GT_414H3-3 (cmhd) CMHD-GT_382F9-3 (cmhd) CMHD-GT_479C3-3 (cmhd)
CMHD-GT_498A2-3 (cmhd) CMHD-GT_171C6-3 (cmhd) CMHD-GT_108B7-3 (cmhd) CMHD-GT_395A9-3 (cmhd)
CMHD-GT_542C4-3 (cmhd) CMHD-GT_450H8-3 (cmhd) CMHD-GT_353A3-3 (cmhd) CMHD-GT_149H1-3 (cmhd)
CMHD-GT_385G8-3 (cmhd) CMHD-GT_533F12-5S (cmhd) CMHD-GT_489G3-3 (cmhd) PST21379-NL (escells)
PSTVUpb17e2 (vanderbilt) PSTVUpb20c2 (vanderbilt) PSTVUpb16b2 (vanderbilt)
PSTVUpb18a7 (vanderbilt) PSTVUpb17e10 (vanderbilt) PSTVUpb20f10 (vanderbilt)
B64 (vanderbilt) PSTVUpb17e5 (vanderbilt) PSTVUpb17d9 (vanderbilt) PSTVUpb15f1 (vanderbilt)
B70 (vanderbilt) IST14374G4 (tigm) IST14729C6 (tigm) IST14939G10 (tigm)
IST14332D6 (tigm) IST12660F6 (tigm) IST14392C10 (tigm) IST11385E12 (tigm)
IST14729C6 (tigm) IST10822F8 (tigm) IST14625C1 (tigm) IST14757C10 (tigm)
IST10742B11 (tigm) IST14392C10 (tigm)
Private Clones OST453336 (lexicon) OST391560 (lexicon) OST356937 (lexicon) OST320862 (lexicon)
OST318073 (lexicon) OST303546 (lexicon) OST299501 (lexicon) OST296814 (lexicon)
OST285267 (lexicon) OST281847 (lexicon) OST257207 (lexicon) OST219727 (lexicon)
OST127655 (lexicon) OST115480 (lexicon) OST113171 (lexicon) OST107809 (lexicon)
OST87429 (lexicon) OST84466 (lexicon) OST47726 (lexicon) OST31553 (lexicon)
OST31365 (lexicon) OST29828 (lexicon) OST29372 (lexicon) OST29297 (lexicon)
OST28830 (lexicon) OST28811 (lexicon) OST28706 (lexicon) OST28468 (lexicon)
OST28342 (lexicon) OST28288 (lexicon) OST28245 (lexicon) OST28063 (lexicon)
OST28048 (lexicon) OST28021 (lexicon) OST27805 (lexicon) OST27594 (lexicon)
OST27537 (lexicon) OST27470 (lexicon) OST27436 (lexicon) OST27391 (lexicon)
OST27316 (lexicon) OST27309 (lexicon) OST27258 (lexicon) OST27136 (lexicon)
OST27027 (lexicon) OST26600 (lexicon) OST26452 (lexicon) OST26074 (lexicon)
OST25997 (lexicon) OST25560 (lexicon) OST25360 (lexicon) OST24985 (lexicon)
OST24757 (lexicon) OST24642 (lexicon) OST24504 (lexicon) OST24014 (lexicon)
OST23826 (lexicon) OST23819 (lexicon) OST23431 (lexicon) OST23392 (lexicon)
OST23168 (lexicon) OST23055 (lexicon) OST22869 (lexicon) OST22620 (lexicon)
OST22233 (lexicon) OST22012 (lexicon) OST21724 (lexicon) OST21211 (lexicon)
OST21113 (lexicon) OST21060 (lexicon) OST20988 (lexicon) OST20763 (lexicon)
OST20470 (lexicon) OST20404 (lexicon) OST20316 (lexicon) OST20299 (lexicon)
OST20233 (lexicon) OST20230 (lexicon) OST19997 (lexicon) OST19952 (lexicon)
OST19693 (lexicon) OST19620 (lexicon) OST19508 (lexicon) OST19386 (lexicon)
OST19210 (lexicon) OST19204 (lexicon) OST19139 (lexicon) OST19061 (lexicon)
OST18948 (lexicon) OST18859 (lexicon) OST18665 (lexicon) OST18635 (lexicon)
OST18513 (lexicon) OST18401 (lexicon) OST18398 (lexicon) OST18363 (lexicon)
OST18174 (lexicon) OST17555 (lexicon) OST17157 (lexicon) OST16964 (lexicon)
OST16420 (lexicon) OST15867 (lexicon) OST15848 (lexicon) OST15417 (lexicon)
OST14342 (lexicon) OST14273 (lexicon) OST14109 (lexicon) OST13948 (lexicon)
OST13838 (lexicon) OST13834 (lexicon) OST13544 (lexicon) OST13353 (lexicon)
OST13325 (lexicon) OST13230 (lexicon) OST13038 (lexicon) OST12895 (lexicon)
OST12692 (lexicon) OST12575 (lexicon) OST12464 (lexicon) OST12133 (lexicon)
OST11729 (lexicon) OST11426 (lexicon) OST11315 (lexicon) OST10703 (lexicon)
OST10341 (lexicon) OST10204 (lexicon) OST9720 (lexicon) OST9579 (lexicon)
OST8112 (lexicon) OST7814 (lexicon) OST7803 (lexicon) OST7722 (lexicon)
OST7688 (lexicon) OST7477 (lexicon) OST7389 (lexicon) OST5719 (lexicon)
OST5637 (lexicon) OST4260 (lexicon) OST4104 (lexicon) OST3741 (lexicon)
OST3092 (lexicon) OST1993 (lexicon) OST1545 (lexicon) OST865 (lexicon)
OST823 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000414877 (Chr11:120721715..120721940 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGTACCCACAGATCGTCTT Chr11:120721808..120721827 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000414877 (Chr11:120721715..120721940 -)
Downstram Exon
ENSMUSE00000414924 (Chr11:120687856..120688238 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGTACCCACAGATCGTCTT Chr11:120721808..120721827 59.99 55 CTTTTGGCTGAGCTTCCATC Chr11:120688106..120688125 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512694 Chr11:120794030..120794186 CGGGAGACGAAGCTAATTCC Chr11:120794054..120794073 61.08 55
upstream ENSMUSE00000401898 Chr11:120782834..120783248 AGCTGGAGCGCTATGATGTT Chr11:120783013..120783032 60.01 50
upstream ENSMUSE00000366049 Chr11:120780787..120780895 TCGATGGTGAACTTGCTCTG Chr11:120780796..120780815 59.98 50
upstream ENSMUSE00000409661 Chr11:120765298..120765399 CGACATGAGCAACGTAGTCC Chr11:120765315..120765334 59.32 55
upstream ENSMUSE00000406389 Chr11:120764837..120764994 AGCTCTGAGAGACGCTGGAG Chr11:120764949..120764968 60.03 60
upstream ENSMUSE00000371022 Chr11:120764630..120764704 ACAGCTGGCCAAGAAGAAAG Chr11:120764652..120764671 59.62 50
upstream ENSMUSE00000414005 Chr11:120763189..120763389 TGAGTGCACAAGAGCAGAGG Chr11:120763220..120763239 60.33 55
upstream ENSMUSE00000367026 Chr11:120759123..120759281 GCCAGATTCCAACAGGACAT Chr11:120759129..120759148 59.93 50
upstream ENSMUSE00000407738 Chr11:120756571..120756733 TGGAGCGTGAACAGGTACAG Chr11:120756670..120756689 59.9 55
upstream ENSMUSE00000380530 Chr11:120755913..120756047 ACGTACACATGGGCTCCTTC Chr11:120755930..120755949 60 55
upstream ENSMUSE00000337249 Chr11:120747164..120747377 TGTTCAAATGCAGACCCTGA Chr11:120747196..120747215 60.24 45
upstream ENSMUSE00000383238 Chr11:120746547..120746699 GACCCTTGAAGCAGAAATGC Chr11:120746670..120746689 59.82 50
upstream ENSMUSE00000396036 Chr11:120743129..120743229 CTCTGGCAGACCAGACATCC Chr11:120743204..120743223 60.83 60
upstream ENSMUSE00000368661 Chr11:120740192..120740362 TCATCCAGGGAGCAGTTACA Chr11:120740199..120740218 59.24 50
upstream ENSMUSE00000356044 Chr11:120734900..120735113 ACCAGACGGAGTCCCCTACT Chr11:120735060..120735079 59.99 60
upstream ENSMUSE00000337295 Chr11:120727869..120727990 TTGCAGCCCTACTCAACAACT Chr11:120727872..120727892 59.93 47.62
upstream ENSMUSE00000309042 Chr11:120722452..120722583 GGAAGAGTCAACCCCACTCA Chr11:120722521..120722540 60.09 55
upstream ENSMUSE00000414877 Chr11:120721715..120721940 CCGTACCCACAGATCGTCTT Chr11:120721808..120721827 59.99 55

*** Putative Vector Insertion (Chr 11: 120688239 - 120721714) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000414924 Chr11:120687856..120688238 CTTTTGGCTGAGCTTCCATC Chr11:120688106..120688125 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCTTTGCATGGCTCTTGA Chr11:120712738..120712758 59.95 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCTTTGCATGGCTCTTGA Chr11:120712738..120712758 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr11:120694871..120694891 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CACTGGGGAGGATAAAGGAG Chr11:120715932..120715952 58.59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048445