Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13
Trapped Gene
Gli2 (ENSMUSG00000048402)
Vector Insertion
Chr 1: 120786979 - 120898616
Public Clones GC0252 (tigem) GC0047 (tigem) GC0568 (tigem) (sanger) CSG015 (baygenomics)
CSD115 (baygenomics) XG045 (baygenomics) A022C05 (ggtc) 3SD053E01 (ggtc)
D053E01 (ggtc) W085C03 (ggtc) 5SD109C01 (ggtc) (ggtc) A048A08 (ggtc)
5SD053E01 (ggtc) 3SD109C01 (ggtc) (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692692 (Chr1:120898617..120898783 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTTGGAGGACAGCAGCTT Chr1:120898679..120898698 59.74 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692692 (Chr1:120898617..120898783 -)
Downstram Exon
ENSMUSE00000475590 (Chr1:120786873..120786978 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTTGGAGGACAGCAGCTT Chr1:120898679..120898698 59.74 55 TCTCATGTCAATCGGCAAAG Chr1:120786904..120786923 59.8 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692693 Chr1:120949879..120950196 CCTGCATGCTAGAGGCAAAC Chr1:120949892..120949911 60.93 55
upstream ENSMUSE00000692692 Chr1:120898617..120898783 CTCTTGGAGGACAGCAGCTT Chr1:120898679..120898698 59.74 55

*** Putative Vector Insertion (Chr 1: 120786979 - 120898616) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000475590 Chr1:120786873..120786978 TCTCATGTCAATCGGCAAAG Chr1:120786904..120786923 59.8 45
downstream ENSMUSE00000234051 Chr1:120764556..120764758 CATATGGGGGTTCACGTAGG Chr1:120764613..120764632 60.07 55
downstream ENSMUSE00000234129 Chr1:120763149..120763334 CATGAGGGTCATCTGGTGGT Chr1:120763221..120763240 60.81 55
downstream ENSMUSE00000426396 Chr1:120752013..120752214 CTACCAGCGAGTTGGGAGAG Chr1:120752064..120752083 60.01 60
downstream ENSMUSE00000597455 Chr1:120751018..120751234 TGGTAGGCCACAGGATTGAT Chr1:120751168..120751187 60.34 50
downstream ENSMUSE00000234014 Chr1:120749835..120749957 CTGACTCGCTGTTCTGCTTG Chr1:120749914..120749933 59.92 55
downstream ENSMUSE00000133480 Chr1:120744960..120745094 CAGTGGCAGTTGGTCTCGTA Chr1:120744984..120745003 59.9 55
downstream ENSMUSE00000659629 Chr1:120742494..120742643 GGCACACGAACTCCTTCTTC Chr1:120742573..120742592 59.85 55
downstream ENSMUSE00000659628 Chr1:120740928..120741092 GTGTGAACGCAGGTGTGTCT Chr1:120741008..120741027 59.79 55
downstream ENSMUSE00000133483 Chr1:120738493..120738774 GGACATGCACATCATTACGC Chr1:120738620..120738639 59.96 50
downstream ENSMUSE00000133482 Chr1:120736831..120737167 TCCATGCCACTGTCATTGTT Chr1:120737057..120737076 59.97 45
downstream ENSMUSE00000469773 Chr1:120730638..120734754 GGATACGCACATGTCTGTGG Chr1:120731127..120731146 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTTCACTCCATTGCCTCA Chr1:120859584..120859604 59.65 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTTCACTCCATTGCCTCA Chr1:120859584..120859604 59.65 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCAGGAGCCTCACCAAGATA Chr1:120859802..120859822 60.36 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATCTGCGTGACTGGGAAAAC Chr1:120859718..120859738 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048402