Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13008
Trapped Gene
Mospd3 (ENSMUSG00000037221)
Vector Insertion
Chr 5: 138038544 - 138040821
Public Clones CMHD-GT_511F7-3 (cmhd) CMHD-GT_354G3-3 (cmhd) CMHD-GT_532B9-5S (cmhd) IST14795H1 (tigm)
IST14833D2 (tigm) IST14793A5 (tigm) IST13152H3 (tigm) IST14483B1 (tigm)
Private Clones OST127317 (lexicon) OST25298 (lexicon) OST22099 (lexicon) OST5452 (lexicon)
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306979 (Chr5:138040822..138041051 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACGAGTGGTTGGAAGAAA Chr5:138040947..138040966 60.09 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306979 (Chr5:138040822..138041051 -)
Downstram Exon
ENSMUSE00000306973 (Chr5:138038379..138038543 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACGAGTGGTTGGAAGAAA Chr5:138040947..138040966 60.09 50 GCAGTGGTAGGAGCAGGAAG Chr5:138038435..138038454 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387892 Chr5:138041970..138042272 AAGAGCAGAGTCCGTCAGGA Chr5:138042083..138042102 60.13 55
upstream ENSMUSE00000343999 Chr5:138041499..138041771 TAGTATTCAGGGCGGACCAG Chr5:138041563..138041582 60.09 55
upstream ENSMUSE00000686289 Chr5:138041499..138041936 TAGTATTCAGGGCGGACCAG Chr5:138041563..138041582 60.09 55
upstream ENSMUSE00000306984 Chr5:138041205..138041280 GTGAAGCCTCAGTCCTGCAT Chr5:138041211..138041230 60.42 55
upstream ENSMUSE00000306979 Chr5:138040822..138041051 GGACGAGTGGTTGGAAGAAA Chr5:138040947..138040966 60.09 50

*** Putative Vector Insertion (Chr 5: 138038544 - 138040821) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306973 Chr5:138038379..138038543 GCAGTGGTAGGAGCAGGAAG Chr5:138038435..138038454 60.01 60
downstream ENSMUSE00000686293 Chr5:138037884..138038281 AGGAGCAAGGTGCAAACATC Chr5:138038143..138038162 60.26 50
downstream ENSMUSE00000379307 Chr5:138037873..138038281 AGGAGCAAGGTGCAAACATC Chr5:138038143..138038162 60.26 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTTGCCTCTCACTTCCTT Chr5:138041067..138041087 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTTGCCTCTCACTTCCTT Chr5:138041067..138041087 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037221