Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13030
Trapped Gene
Fbxl10 (ENSMUSG00000029475)
Vector Insertion
Chr 5: 123437816 - 123438475
Public Clones E001D12 (ggtc) CMHD-GT_335F9-3 (cmhd) CMHD-GT_338G9-3 (cmhd) CMHD-GT_476E12-3 (cmhd)
PST1047-1 (escells) IST10830H6 (tigm) IST10080H3 (tigm)
Private Clones OST369482 (lexicon) OST298443 (lexicon) OST296716 (lexicon) OST265313 (lexicon)
OST251631 (lexicon) OST210475 (lexicon) OST193061 (lexicon) OST170796 (lexicon)
OST155668 (lexicon) OST149792 (lexicon) OST142588 (lexicon) OST103257 (lexicon)
OST99611 (lexicon) OST9963 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000593008 (Chr5:123438476..123438542 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGGAGTCTCCTTAGGAAGTG Chr5:123438516..123438536 59.19 57.14 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000593008 (Chr5:123438476..123438542 -)
Downstram Exon
ENSMUSE00000338385 (Chr5:123437671..123437815 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGGAGTCTCCTTAGGAAGTG Chr5:123438516..123438536 59.19 57.14 ACGTCCGACAAGTCTTCGTT Chr5:123437744..123437763 59.77 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000717210 Chr5:123439634..123439832 CGCAAATGGATAAGGGTCTG Chr5:123439731..123439750 60.46 50
upstream ENSMUSE00000518745 Chr5:123438877..123438909 No primer for this exon
upstream ENSMUSE00000714097 Chr5:123438877..123439315 TTACGTTCCGGGGATTATGA Chr5:123439130..123439149 60.15 45
upstream ENSMUSE00000593008 Chr5:123438476..123438542 GGGGAGTCTCCTTAGGAAGTG Chr5:123438516..123438536 59.19 57.14

*** Putative Vector Insertion (Chr 5: 123437816 - 123438475) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000338385 Chr5:123437671..123437815 ACGTCCGACAAGTCTTCGTT Chr5:123437744..123437763 59.77 50
downstream ENSMUSE00000376150 Chr5:123434471..123434549 CCATCCTTGTCCCGAAAAAC Chr5:123434461..123434480 61.6 50
downstream ENSMUSE00000328593 Chr5:123432786..123432832 TGACGTCTCGGACTGTGAAA Chr5:123432776..123432795 60.44 50
downstream ENSMUSE00000328661 Chr5:123411419..123411597 TCATCTCGGTACCCTTCTGG Chr5:123411519..123411538 60.06 55
downstream ENSMUSE00000328656 Chr5:123411022..123411128 CACATGTTGTCCACCCAGTC Chr5:123411075..123411094 59.85 55
downstream ENSMUSE00000328651 Chr5:123399079..123399172 CCTTCACGCTCATCAGACAG Chr5:123399128..123399147 59.57 55
downstream ENSMUSE00000328643 Chr5:123397736..123397889 ACCCACTCCTCGTACAAAGC Chr5:123397812..123397831 59.21 55
downstream ENSMUSE00000328635 Chr5:123390962..123391077 CACGTTGAAGCTATGCAGGA Chr5:123390982..123391001 60.01 50
downstream ENSMUSE00000328629 Chr5:123384742..123384868 TAACGGAACTTGGGCTGAAC Chr5:123384827..123384846 60.11 50
downstream ENSMUSE00000331402 Chr5:123382476..123382960 CCGGAAGGGACTCTAGCTTT Chr5:123382516..123382535 59.84 55
downstream ENSMUSE00000382139 Chr5:123371394..123371480 CATCCACGTGCTCTTTCAGT Chr5:123371434..123371453 58.88 50
downstream ENSMUSE00000537526 Chr5:123350158..123350359 GGCTCCGATTCATAGTCGTC Chr5:123350143..123350162 59.66 55
downstream ENSMUSE00000328745 Chr5:123338539..123338763 AGTGGCACTCTCCACACTCC Chr5:123338591..123338610 60.31 60
downstream ENSMUSE00000437855 Chr5:123333328..123333471 GTGGATGATCTCGTTGCAGA Chr5:123333321..123333340 59.79 50
downstream ENSMUSE00000247403 Chr5:123332411..123332497 GAAGCTCATCGTTGACCACA Chr5:123332439..123332458 59.84 50
downstream ENSMUSE00000437831 Chr5:123331973..123332233 CTTGTTGTCCCGGTTCATCT Chr5:123332128..123332147 59.97 50
downstream ENSMUSE00000437825 Chr5:123331646..123331759 GGCTGAGACTGCTGCCTAGA Chr5:123331662..123331681 60.84 60
downstream ENSMUSE00000437822 Chr5:123331029..123331067 No primer for this exon
downstream ENSMUSE00000412900 Chr5:123330182..123330861 GTGAGCTGGAACGTGACTGA Chr5:123330701..123330720 60.03 55
downstream ENSMUSE00000189235 Chr5:123329498..123329661 CCAACTGAGGTCAAGGGAGA Chr5:123329525..123329544 60.23 55
downstream ENSMUSE00000189228 Chr5:123329254..123329415 CCTCATCTGGGCATCCTTTA Chr5:123329266..123329285 60.03 50
downstream ENSMUSE00000189233 Chr5:123328444..123328662 AGGCGCAGCTCTACAATGTT Chr5:123328592..123328611 60.04 50
downstream ENSMUSE00000716214 Chr5:123321714..123321906 AGCGTTTGAAGAAGGACAGG Chr5:123321840..123321859 59.47 50
downstream ENSMUSE00000593009 Chr5:123320690..123321906 TGCATCAGGGAAAGGTTAGG Chr5:123320702..123320721 60.07 50
downstream ENSMUSE00000719227 Chr5:123320688..123321906 TGCATCAGGGAAAGGTTAGG Chr5:123320702..123320721 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGTTTTGGGGTCTCTGATAG Chr5:123438451..123438472 60.99 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTGGGGTCTCTGATAGAAGC Chr5:123438447..123438469 59.72 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr5:123438473..123438493 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGGAGTCTCCTTAGGAAGTG Chr5:123438514..123438535 59.19 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029475