Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13032
Trapped Gene
BC033915 (ENSMUSG00000034135)
Vector Insertion
Chr 9: 45821214 - 45931299
Public Clones CMHD-GT_338A3-3 (cmhd) (cmhd) IST14706C3 (tigm) IST12980C2 (tigm)
IST14714H3 (tigm) IST14714H3 (tigm) IST14406G5 (tigm)
Private Clones OST464425 (lexicon) OST461681 (lexicon) OST414622 (lexicon) OST394071 (lexicon)
OST388382 (lexicon) OST375507 (lexicon) OST375365 (lexicon) OST360042 (lexicon)
OST328589 (lexicon) OST325609 (lexicon) OST322769 (lexicon) OST318832 (lexicon)
OST295388 (lexicon) OST246075 (lexicon) OST244356 (lexicon) OST202481 (lexicon)
OST169911 (lexicon) OST141694 (lexicon) OST129509 (lexicon) OST44455 (lexicon)
OST44434 (lexicon) OST43215 (lexicon) OST42948 (lexicon) OST23629 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000509505 (Chr9:45821107..45821213 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCATCGGCTACTACGAGAT Chr9:45821124..45821143 60.4 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000509505 (Chr9:45821107..45821213 +)
Downstram Exon
ENSMUSE00000508466 (Chr9:45931300..45931416 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCATCGGCTACTACGAGAT Chr9:45821124..45821143 60.4 55 TCCCGGAAAATCTTCTTCAA Chr9:45931367..45931386 59.62 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716228 Chr9:45820955..45821213 CGCATCGGCTACTACGAGAT Chr9:45821124..45821143 60.4 55
upstream ENSMUSE00000708962 Chr9:45821083..45821213 CGCATCGGCTACTACGAGAT Chr9:45821124..45821143 60.4 55
upstream ENSMUSE00000509505 Chr9:45821107..45821213 CGCATCGGCTACTACGAGAT Chr9:45821124..45821143 60.4 55

*** Putative Vector Insertion (Chr 9: 45821214 - 45931299) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000508466 Chr9:45931300..45931416 TCCCGGAAAATCTTCTTCAA Chr9:45931367..45931386 59.62 40
downstream ENSMUSE00000251521 Chr9:45935093..45935156 AAATCATGCGCTCTGTCTCC Chr9:45935120..45935139 60.37 50
downstream ENSMUSE00000251500 Chr9:45963462..45963623 TTTGAACTTCCGTCGAGCTT Chr9:45963520..45963539 59.99 45
downstream ENSMUSE00000216314 Chr9:45985955..45986079 TGGAGTGAAGAGGTTGCTGA Chr9:45985986..45986005 59.54 50
downstream ENSMUSE00000216320 Chr9:45986515..45986638 GGACATAAAGAACGGGATGC Chr9:45986637..45986656 59.39 50
downstream ENSMUSE00000535595 Chr9:46002246..46002364 TCTCCGAGCTTCATCCACTT Chr9:46002345..46002364 59.95 50
downstream ENSMUSE00000535593 Chr9:46002903..46003013 CAGCCCCATGTCTTCCATAG Chr9:46002995..46003014 60.47 55
downstream ENSMUSE00000535592 Chr9:46003249..46003392 CGGGACGCAGAGTTTTATGT Chr9:46003339..46003358 60.13 50
downstream ENSMUSE00000473458 Chr9:46003876..46003953 GAACTTGAGGGACGCTAAGG Chr9:46003924..46003943 58.93 55
downstream ENSMUSE00000472651 Chr9:46004067..46004176 TGTGCCTCCTCATTGACAAA Chr9:46004157..46004176 60.24 45
downstream ENSMUSE00000535589 Chr9:46006230..46006383 CAACAGGTTGTGCGTGAAGT Chr9:46006344..46006363 59.79 50
downstream ENSMUSE00000535588 Chr9:46006635..46006790 GCTGTAGTGTAGGCGGCTGT Chr9:46006671..46006690 60.48 60
downstream ENSMUSE00000469567 Chr9:46010083..46010153 TCCTCATCCACAGGGGTAAC Chr9:46010117..46010136 59.78 55
downstream ENSMUSE00000468488 Chr9:46012289..46012432 TGCCTTTTGGACCTATTTGC Chr9:46012318..46012337 60.07 45
downstream ENSMUSE00000471583 Chr9:46016005..46016155 GAGATGCAGGGTGTTGGAGT Chr9:46016041..46016060 60.12 55
downstream ENSMUSE00000462543 Chr9:46016801..46016926 CTGCTGGAGGATCTGATGGT Chr9:46016920..46016939 60.22 55
downstream ENSMUSE00000465486 Chr9:46017147..46017232 GTTGGTTTTCACAGGCAACC Chr9:46017207..46017226 60.4 50
downstream ENSMUSE00000467470 Chr9:46017638..46017747 GAGACGTGATCATGGCACTG Chr9:46017747..46017766 60.28 55
downstream ENSMUSE00000466468 Chr9:46018559..46018898 CCCAGGCAGGTTAGTGCTAC Chr9:46018670..46018689 59.76 60
downstream ENSMUSE00000535584 Chr9:46019753..46020645 ACTGGTCCGAAAACAGATGG Chr9:46019829..46019848 59.97 50
downstream ENSMUSE00000710331 Chr9:46019933..46020645 TGTTGCTGCCTTTTGATGAG Chr9:46020136..46020155 59.99 45
downstream ENSMUSE00000535583 Chr9:46027509..46027672 ATAGGCATCGTCGCTGTTCT Chr9:46027675..46027694 59.87 50
downstream ENSMUSE00000535581 Chr9:46028293..46028425 CATTCCTGGCAAGGTATCCA Chr9:46028322..46028341 60.85 50
downstream ENSMUSE00000535577 Chr9:46029150..46029317 CGTAGCTGGATAGCGAGAGG Chr9:46029235..46029254 60.13 60
downstream ENSMUSE00000484973 Chr9:46030152..46032269 TAGCCACTGCCTATGTGCTG Chr9:46031406..46031425 60.03 55
downstream ENSMUSE00000713173 Chr9:46030152..46030358 CCTTGGTGCCTTGGTCATAC Chr9:46030348..46030367 60.38 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTGTTGGCTTTAATCTCTGAT Chr9:45899165..45899188 60.01 39.13 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGTTGGCTTTAATCTCTGAT Chr9:45899165..45899188 60.01 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034135