Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13036
Trapped Gene
Cap2 (ENSMUSG00000021373)
Vector Insertion
Chr 13: 46735492 - 46741894
Public Clones CMHD-GT_418A3-3 (cmhd) CMHD-GT_359C5-3 (cmhd)
Private Clones OST64807 (lexicon) OST27682 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000571068 (Chr13:46735409..46735491 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000571068 (Chr13:46735409..46735491 +)
Downstram Exon
ENSMUSE00000117402 (Chr13:46741895..46742035 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718498 Chr13:46597494..46597580 No primer for this exon
upstream ENSMUSE00000571069 Chr13:46597516..46597580 No primer for this exon
upstream ENSMUSE00000278926 Chr13:46620784..46620905 No primer for this exon
upstream ENSMUSE00000720412 Chr13:46620784..46620905 No primer for this exon
upstream ENSMUSE00000278920 Chr13:46626346..46626446 No primer for this exon
upstream ENSMUSE00000490873 Chr13:46655873..46655950 No primer for this exon
upstream ENSMUSE00000278905 Chr13:46704965..46705108 No primer for this exon
upstream ENSMUSE00000117408 Chr13:46705433..46705518 No primer for this exon
upstream ENSMUSE00000117401 Chr13:46710619..46710724 No primer for this exon
upstream ENSMUSE00000117405 Chr13:46730990..46731179 No primer for this exon
upstream ENSMUSE00000117406 Chr13:46733218..46733390 No primer for this exon
upstream ENSMUSE00000117404 Chr13:46735192..46735315 No primer for this exon
upstream ENSMUSE00000571068 Chr13:46735409..46735491 No primer for this exon

*** Putative Vector Insertion (Chr 13: 46735492 - 46741894) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000117402 Chr13:46741895..46742035 No primer for this exon
downstream ENSMUSE00000278846 Chr13:46743650..46745634 No primer for this exon
downstream ENSMUSE00000719471 Chr13:46743650..46745004 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGCATGATAATCGCCTTG Chr13:46741534..46741554 59.79 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAATCGTGACTGGGAAAAC Chr13:46741537..46741558 59.96 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021373