Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13048
Trapped Gene
Gap43 (ENSMUSG00000047261)
Vector Insertion
Chr 16: 42249228 - 42291911
Public Clones CMHD-GT_497A10-3 (cmhd) CMHD-GT_359C7-3 (cmhd)
Private Clones OST179775 (lexicon) OST28142 (lexicon) OST24599 (lexicon) OST9095 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662699 (Chr16:42291912..42292479 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGTCAAGCCGGAAGATAA Chr16:42292421..42292440 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662699 (Chr16:42291912..42292479 -)
Downstram Exon
ENSMUSE00000662698 (Chr16:42248557..42249227 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGTCAAGCCGGAAGATAA Chr16:42292421..42292440 60.07 50 GAACGGAACATTGCACACAC Chr16:42248743..42248762 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662700 Chr16:42340586..42340665 AAGGCAGGGGAAGATACCAC Chr16:42340617..42340636 60.33 55
upstream ENSMUSE00000662699 Chr16:42291912..42292479 GGTGTCAAGCCGGAAGATAA Chr16:42292421..42292440 60.07 50

*** Putative Vector Insertion (Chr 16: 42249228 - 42291911) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662698 Chr16:42248557..42249227 GAACGGAACATTGCACACAC Chr16:42248743..42248762 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATATCCATAATCGCCTTGCAG Chr16:42276846..42276867 59.07 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTGCATATGTTCCGTGAC Chr16:42276854..42276874 60.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047261