Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13050
Trapped Gene
Pip5kl1 (ENSMUSG00000046854)
Vector Insertion
Chr 2: 32438792 - 32439292
Public Clones CMHD-GT_359A6-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000351890 (Chr2:32438793..32439296 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTACGCTATCCAGGCCAGAG Chr2:32438971..32438990 59.86 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000351890 (Chr2:32438793..32439296 +)
Downstram Exon
ENSMUSE00000603968 (Chr2:32438793..32439291 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTACGCTATCCAGGCCAGAG Chr2:32438971..32438990 59.86 60 TTCGACTTCGACACACCTTG Chr2:32438822..32438841 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000705009 Chr2:32431238..32431414 TGGGCACAGTGGTAACAAGA Chr2:32431266..32431285 60.15 50
upstream ENSMUSE00000517027 Chr2:32431339..32431414 No primer for this exon
upstream ENSMUSE00000645891 Chr2:32431363..32431540 GGGTGAAAGTCTGGCCATTA Chr2:32431450..32431469 59.93 50
upstream ENSMUSE00000514048 Chr2:32432171..32432371 ATGACACGAATGATGCAGGA Chr2:32432306..32432325 60.08 45
upstream ENSMUSE00000515826 Chr2:32433392..32433445 CATGACCCAAGTTCACGAAG Chr2:32433424..32433443 59.13 50
upstream ENSMUSE00000520550 Chr2:32433629..32433783 ATTGGCCTGACTGAAGAGGA Chr2:32433683..32433702 59.8 50
upstream ENSMUSE00000521332 Chr2:32434000..32434124 ACCAGCGCTTCTTTGTGAAG Chr2:32434005..32434024 60.57 50
upstream ENSMUSE00000489534 Chr2:32434456..32434490 TACAGTCTGCGGGTAGCTCA Chr2:32434461..32434480 59.62 55
upstream ENSMUSE00000490545 Chr2:32434578..32434633 CTACCAGCCGCATTTCTGAG Chr2:32434612..32434631 60.92 55
upstream ENSMUSE00000363083 Chr2:32435461..32435573 AACATAAGCCGCTGGGTAGA Chr2:32435480..32435499 59.73 50
upstream ENSMUSE00000391646 Chr2:32435799..32435949 CTGCGGGAGGTGAATGTACT Chr2:32435849..32435868 60.13 55
upstream ENSMUSE00000645890 Chr2:32436466..32436692 GACCACGCACTGACTCTTGA Chr2:32436508..32436527 60.03 55

*** Putative Vector Insertion (Chr 2: 32438792 - 32439292) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000351890 Chr2:32438793..32439296 TTCGACTTCGACACACCTTG Chr2:32438822..32438841 59.87 50
downstream ENSMUSE00000603967 Chr2:32438793..32439302 TTCGACTTCGACACACCTTG Chr2:32438822..32438841 59.87 50
downstream ENSMUSE00000603968 Chr2:32438793..32439291 TTCGACTTCGACACACCTTG Chr2:32438822..32438841 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTGTGTCGAAGTCGAAGG Chr2:32438803..32438823 60.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTCCATACAAGGTGTGTCG Chr2:32438792..32438813 59.9 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046854