Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13053
Trapped Gene
Sac3d1 (ENSMUSG00000024790)
Vector Insertion
Chr 19: 6116547 - 6116588
Public Clones CMHD-GT_363F9-3 (cmhd) CMHD-GT_358D12-3 (cmhd)
Private Clones OST262695 (lexicon) OST144570 (lexicon) OST21974 (lexicon) OST5767 (lexicon)
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695981 (Chr19:6116548..6116588 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCCTGCAGGAGGTTCTAC Chr19:6116558..6116577 60.79 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695981 (Chr19:6116548..6116588 -)
Downstram Exon
ENSMUSE00000695982 (Chr19:6116004..6116587 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCCTGCAGGAGGTTCTAC Chr19:6116558..6116577 60.79 60 GACGAGACCCTCTCAAGCTG Chr19:6116060..6116079 60.13 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000402337 Chr19:6117797..6118586 GCGCACAGTGAAGGAGTACA Chr19:6118208..6118227 60.06 55
upstream ENSMUSE00000706958 Chr19:6117797..6118586 GCGCACAGTGAAGGAGTACA Chr19:6118208..6118227 60.06 55
upstream ENSMUSE00000695981 Chr19:6116548..6116588 AGCCCTGCAGGAGGTTCTAC Chr19:6116558..6116577 60.79 60

*** Putative Vector Insertion (Chr 19: 6116547 - 6116588) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000144987 Chr19:6116094..6116543 GTAGGGTAAGGTGCGAAGCA Chr19:6116420..6116439 60.27 55
downstream ENSMUSE00000695982 Chr19:6116004..6116587 GACGAGACCCTCTCAAGCTG Chr19:6116060..6116079 60.13 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTCTACAGCTGCCTGCTT Chr19:6116544..6116564 59.64 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTCTACAGCTGCCTGCTC Chr19:6116544..6116564 60.16 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024790