Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13055
Trapped Gene
Mapbpip (ENSMUSG00000028062)
Vector Insertion
Chr 3: 88356440 - 88356651
Public Clones (sanger) CMHD-GT_342E5-3 (cmhd) CMHD-GT_365C6-3 (cmhd)
Private Clones OST401981 (lexicon) OST401980 (lexicon) OST313074 (lexicon) OST104275 (lexicon)
OST79537 (lexicon) OST36226 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719880 (Chr3:88356652..88356781 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGAGCACCCTGTGAGTGAA Chr3:88356709..88356728 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719880 (Chr3:88356652..88356781 -)
Downstram Exon
ENSMUSE00000175602 (Chr3:88356277..88356439 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGAGCACCCTGTGAGTGAA Chr3:88356709..88356728 60.02 55 TTCCCGTTCCTATCATACGC Chr3:88356304..88356323 59.92 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000395088 Chr3:88356718..88356844 GGTGCAGGTCAGGGTTAAGA Chr3:88356795..88356814 60.11 55
upstream ENSMUSE00000719880 Chr3:88356652..88356781 CAGAGCACCCTGTGAGTGAA Chr3:88356709..88356728 60.02 55

*** Putative Vector Insertion (Chr 3: 88356440 - 88356651) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175602 Chr3:88356277..88356439 TTCCCGTTCCTATCATACGC Chr3:88356304..88356323 59.92 50
downstream ENSMUSE00000712689 Chr3:88356277..88356439 TTCCCGTTCCTATCATACGC Chr3:88356304..88356323 59.92 50
downstream ENSMUSE00000175605 Chr3:88354618..88354707 TTGAGCATTCCGAAGCCTAC Chr3:88354603..88354622 60.35 50
downstream ENSMUSE00000175603 Chr3:88353742..88353926 CCATCACGCTGTTATGATGC Chr3:88353837..88353856 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCTGCAGTAGGGGTAGGG Chr3:88356644..88356664 60.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCTGCAGTAGGGGTAGGG Chr3:88356644..88356664 60.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCCAACACTGGAGGTAATCG Chr3:88356725..88356745 60.52 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000028062