Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13061
Trapped Gene
Fbxo36 (ENSMUSG00000073633)
Vector Insertion
Chr 1: 84836544 - 84877666
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) E072A06 (ggtc) (ggtc)
D135C10 (ggtc) D159G06 (ggtc) (ggtc) D087G01 (ggtc) E115A12 (ggtc)
(ggtc) D135C10 (ggtc) CMHD-GT_513E8-3 (cmhd) CMHD-GT_403H9-3 (cmhd) CMHD-GT_443H9-3 (cmhd)
CMHD-GT_343A12-3 (cmhd) CMHD-GT_540F2-5S (cmhd) CMHD-GT_180G7-3 (cmhd) CMHD-GT_513C5-3 (cmhd)
CMHD-GT_424B2-3 (cmhd) CMHD-GT_522A10-5S (cmhd) (cmhd) CMHD-GT_304E3-3 (cmhd)
CMHD-GT_234D5-3 (cmhd) CMHD-GT_498C11-3 (cmhd) CMHD-GT_171C3-3S (cmhd) CMHD-GT_260F5-3 (cmhd)
FHCRC-GT-S11-4C1 (fhcrc) FHCRC-GT-S23-2B1 (fhcrc) PST12543-NL (escells)
IST14119G5 (tigm) IST11250H3 (tigm) IST12339A10 (tigm) IST13632H12 (tigm)
IST13172B2 (tigm) IST12294E5 (tigm) IST10747C8 (tigm) IST14299E10 (tigm)
IST11638A11 (tigm) IST10973D2 (tigm) IST10244B6 (tigm) IST14465D5 (tigm)
IST12836A2 (tigm) IST12492F11 (tigm) IST13918D5 (tigm) IST11171G5 (tigm)
IST12593B5 (tigm) IST14141B5 (tigm) IST11401D6 (tigm) IST11437B11 (tigm)
IST11775G5 (tigm) IST12107F3 (tigm) IST12455A9 (tigm) IST11549F4 (tigm)
IST13137G11 (tigm) IST13233C2 (tigm) IST13947G11 (tigm) IST11873C6 (tigm)
IST13155G9 (tigm) IST11359G10 (tigm) IST10907C5 (tigm) IST12950B10 (tigm)
IST13659B10 (tigm) IST12669F7 (tigm) IST13119C11 (tigm) IST13241E3 (tigm)
IST15068F8 (tigm) IST14269F9 (tigm) IST11171G5 (tigm) IST10810H3 (tigm)
IST14381C11 (tigm) IST11745D3 (tigm) IST10263A12 (tigm) IST12232C10 (tigm)
IST13113D4 (tigm) IST12481A10 (tigm) IST13396F8 (tigm) IST15055E11 (tigm)
IST12503E9 (tigm) IST14674B4 (tigm) IST11541H4 (tigm) IST10313A1 (tigm)
IST11014D3 (tigm) IST10177H11 (tigm) IST12397A5 (tigm) IST13103C8 (tigm)
IST10082F8 (tigm) IST13186F7 (tigm) IST11266C2 (tigm) IST10572E7 (tigm)
IST14046G5 (tigm) IST10247E11 (tigm) IST11006H5 (tigm) IST11435C9 (tigm)
IST14759D1 (tigm) IST13885G4 (tigm) IST13961F2 (tigm) IST14415B5 (tigm)
IST12002A3 (tigm) IST10398H10 (tigm) IST13202C10 (tigm) IST14975F3 (tigm)
IST10958G11 (tigm) IST13087C3 (tigm) IST11508A9 (tigm) IST14189A12 (tigm)
IST13046A9 (tigm) IST14347A5 (tigm) IST12921D11 (tigm) IST14289F3 (tigm)
IST14505E2 (tigm) IST12358G3 (tigm) IST10564F12 (tigm) IST14734D7 (tigm)
IST10026B3 (tigm) IST12347F9 (tigm) IST12986E3 (tigm) IST14691F2 (tigm)
IST14667E6 (tigm) IST14959A1 (tigm) IST14165B8 (tigm) IST14259H5 (tigm)
IST11736H11 (tigm) IST12273E8 (tigm) IST14716B11 (tigm) IST10749E8 (tigm)
IST14926H11 (tigm) IST10754B9 (tigm) IST10250E4 (tigm) IST11797F4 (tigm)
IST10485H5 (tigm) IST12846G1 (tigm) IST10462A9 (tigm) IST10410F3 (tigm)
IST10837G2 (tigm) IST11348H6 (tigm) IST11972E12 (tigm) IST11865D12 (tigm)
IST10446C9 (tigm) IST10250E4 (tigm) IST12384C10 (tigm) IST14625G7 (tigm)
IST12977D3 (tigm) IST10480F6 (tigm) IST10018H8 (tigm) IST14363B5 (tigm)
IST11807C1 (tigm) IST10920G9 (tigm) IST14601B11 (tigm) IST14278A11 (tigm)
IST12294E5 (tigm) IST10673D11 (tigm) IST12429F12 (tigm) IST10945D2 (tigm)
IST13155G9 (tigm) IST13909C10 (tigm) IST12335A4 (tigm) IST10445E11 (tigm)
IST13718F11 (tigm) IST13697H11 (tigm) IST10365A7 (tigm) IST13233C2 (tigm)
IST11078H5 (tigm) IST12036G3 (tigm) IST13373D2 (tigm) IST12346C6 (tigm)
IST10072C9 (tigm) IST11056G5 (tigm) IST14003F11 (tigm) IST14732A1 (tigm)
IST14701D1 (tigm) IST11064C5 (tigm) IST14791H11 (tigm) IST14759D1 (tigm)
IST14862A1 (tigm) IST14179A12 (tigm) IST11529E8 (tigm) IST12417D12 (tigm)
IST10829E12 (tigm) IST12556C7 (tigm) IST10075A9 (tigm) IST14549F2 (tigm)
IST12839G3 (tigm) IST12674B4 (tigm) IST14375B5 (tigm) IST10210A9 (tigm)
IST12422F10 (tigm) IST12304H4 (tigm) IST11745D3 (tigm) IST14511F12 (tigm)
IST11112D8 (tigm) IST11586F9 (tigm) IST12074E10 (tigm) IST13636F1 (tigm)
IST13784D9 (tigm) IST10063C6 (tigm) IST13435A6 (tigm) IST14129C6 (tigm)
IST13759H3 (tigm) IST11731D11 (tigm) IST11336B11 (tigm) IST14720A5 (tigm)
IST11534E8 (tigm) IST11579F6 (tigm) IST10439H2 (tigm) IST10085B11 (tigm)
IST14317F6 (tigm) IST13976F3 (tigm) IST14157D2 (tigm) IST14903G6 (tigm)
IST11056G5 (tigm) IST10356E12 (tigm) IST13759H3 (tigm) IST13169F8 (tigm)
IST11688H11 (tigm) IST13094E7 (tigm) IST14757E6 (tigm) IST11839F6 (tigm)
IST13503F5 (tigm) IST11250H3 (tigm) IST14259A12 (tigm) IST14432H9 (tigm)
IST12556C7 (tigm) IST15029B7 (tigm) IST14975F3 (tigm) IST13969A6 (tigm)
IST13918D5 (tigm) IST14902C10 (tigm) IST11623C11 (tigm) IST14344G8 (tigm)
IST11494C1 (tigm) IST12830F1 (tigm) IST14843H8 (tigm) IST11533E8 (tigm)
IST14269F9 (tigm) IST12013C2 (tigm) IST11111C7 (tigm) IST13237E8 (tigm)
IST10854G7 (tigm) IST14886G3 (tigm) IST10228C6 (tigm) IST14035H8 (tigm)
IST13158D6 (tigm) IST10663D8 (tigm) IST10219G10 (tigm) IST10210A4 (tigm)
IST12669F7 (tigm) IST12965A7 (tigm) IST10612E9 (tigm) IST10156B4 (tigm)
IST14505E2 (tigm) IST12358G3 (tigm) IST13911E1 (tigm) IST10175A5 (tigm)
IST14565E6 (tigm) IST10617F4 (tigm) IST15112B5 (tigm) IST12559F9 (tigm)
IST12969B2 (tigm) IST14561H10 (tigm) IST15055C3 (tigm) IST10747C8 (tigm)
IST11405H11 (tigm) IST15025E5 (tigm) IST14754G7 (tigm) IST12000C12 (tigm)
IST11115C5 (tigm) IST14653D10 (tigm) IST14680F12 (tigm) IST11064C5 (tigm)
IST10247E11 (tigm) IST14082E4 (tigm) IST14112B11 (tigm) IST14498H10 (tigm)
IST13241E3 (tigm) IST10879D10 (tigm) IST10565D6 (tigm) IST12339A10 (tigm)
IST10549D1 (tigm) IST12953D8 (tigm) IST10754B9 (tigm) IST11112D8 (tigm)
IST12335A4 (tigm) IST13615G1 (tigm) IST14525H2 (tigm) IST10049A2 (tigm)
IST10343C6 (tigm) IST11039B2 (tigm) IST12074E10 (tigm) IST13237G5 (tigm)
IST12503E9 (tigm) IST12429F12 (tigm) IST14381C11 (tigm) IST10837E1 (tigm)
IST10290F4 (tigm) IST11444F7 (tigm) IST13828E6 (tigm) IST11658C12 (tigm)
IST14217H6 (tigm) IST15011H2 (tigm) IST12063E5 (tigm) IST10368D5 (tigm)
IST12023B2 (tigm) IST11204B11 (tigm) IST11551E12 (tigm) IST12032F1 (tigm)
IST10338D3 (tigm) IST11829F11 (tigm) IST14094E8 (tigm) IST13185G2 (tigm)
IST12633A10 (tigm) IST13289H2 (tigm) IST14035H8 (tigm) IST15112B5 (tigm)
IST11541H4 (tigm) IST14719E8 (tigm) IST14886B10 (tigm) IST12767G1 (tigm)
IST14255B11 (tigm) IST10543E10 (tigm) IST12953D8 (tigm) IST13963E10 (tigm)
IST13784D9 (tigm) IST11457D2 (tigm) IST14289F3 (tigm) IST12863B11 (tigm)
IST10125B4 (tigm) IST14182H5 (tigm) IST11300C8 (tigm) IST13192G6 (tigm)
IST10909H4 (tigm) IST10900C1 (tigm) IST12472A8 (tigm) IST12921D11 (tigm)
IST14121F8 (tigm) IST13746E5 (tigm) IST14891F4 (tigm) IST14784C4 (tigm)
IST12355A4 (tigm) IST10909C12 (tigm) IST11593E9 (tigm) IST12002A3 (tigm)
IST13398C7 (tigm) IST10565D6 (tigm) IST12384D10 (tigm) IST12969B2 (tigm)
IST14465D5 (tigm) IST10407E6 (tigm) IST12397A5 (tigm) IST12000C12 (tigm)
IST14259A12 (tigm) IST11793A9 (tigm) IST14408B12 (tigm) IST10501F11 (tigm)
IST12788G1 (tigm) IST14121B3 (tigm) IST12668G4 (tigm) IST13531B2 (tigm)
IST13503F5 (tigm) IST10368H12 (tigm) IST10226E5 (tigm) IST10834H3 (tigm)
IST11102D8 (tigm) IST12461F3 (tigm) IST10934A5 (tigm) IST13360A9 (tigm)
IST14516F7 (tigm) IST13087C3 (tigm) IST10246B9 (tigm) IST10572E7 (tigm)
IST10811A11 (tigm) IST10356E12 (tigm) IST13158D6 (tigm) IST11102D8 (tigm)
IST14278A11 (tigm) IST13293C3 (tigm) IST12129D1 (tigm) IST11547B12 (tigm)
IST10839C8 (tigm) IST14255B11 (tigm) IST14691F2 (tigm) IST14791H11 (tigm)
IST10316D4 (tigm) IST10871B10 (tigm) IST10315E10 (tigm) IST12537E9 (tigm)
IST11051G12 (tigm) IST12384D10 (tigm) IST12943E10 (tigm) IST14021C1 (tigm)
IST13706E10 (tigm) IST11494C1 (tigm) IST14305E12 (tigm) IST11468A4 (tigm)
IST12788G1 (tigm) IST12083H9 (tigm) IST14179B10 (tigm) IST14913B9 (tigm)
IST15056B12 (tigm) IST13260A12 (tigm) IST15086F10 (tigm) IST14262H5 (tigm)
IST13857H8 (tigm) IST10342G11 (tigm) IST13681E10 (tigm) IST14796E9 (tigm)
IST12146C4 (tigm) IST12889D6 (tigm) IST10305B11 (tigm) IST14162C12 (tigm)
IST12258A7 (tigm) IST14900F3 (tigm) IST11356E12 (tigm) IST10047B4 (tigm)
IST12668G4 (tigm) IST14347A5 (tigm) IST11816A6 (tigm) IST14332A7 (tigm)
IST13257F6 (tigm) IST14798H2 (tigm) IST13119C11 (tigm) IST11078F6 (tigm)
IST12384C10 (tigm) IST14210H5 (tigm) IST12237C7 (tigm) IST11868B9 (tigm)
IST10961H5 (tigm) IST12760A10 (tigm) IST13342E4 (tigm) IST11078H5 (tigm)
IST13644G10 (tigm) IST14981D9 (tigm) IST13947G11 (tigm) IST14176G10 (tigm)
IST10911F5 (tigm) IST13479G9 (tigm) IST12417D12 (tigm) IST14577C11 (tigm)
IST14553C8 (tigm) IST15074H11 (tigm) IST12036G3 (tigm) IST11488E7 (tigm)
IST10220D6 (tigm) IST13632H12 (tigm) IST14806H2 (tigm) IST15060C8 (tigm)
IST11651C3 (tigm) IST10836G11 (tigm) IST14521B4 (tigm) IST14833C4 (tigm)
IST10343C6 (tigm) IST10197C12 (tigm) IST12023B2 (tigm) IST11078F6 (tigm)
IST14703H12 (tigm) IST13636F1 (tigm) IST11402E9 (tigm) IST10900D7 (tigm)
IST10762G6 (tigm) IST10104A9 (tigm) IST10466D12 (tigm) IST10762H10 (tigm)
IST13123F6 (tigm) IST14754G7 (tigm)
Private Clones OST441339 (lexicon) OST378009 (lexicon) OST337959 (lexicon) OST334187 (lexicon)
OST330133 (lexicon) OST321305 (lexicon) OST320504 (lexicon) OST318883 (lexicon)
OST299861 (lexicon) OST299196 (lexicon) OST293865 (lexicon) OST292035 (lexicon)
OST287673 (lexicon) OST281949 (lexicon) OST280286 (lexicon) OST276905 (lexicon)
OST275721 (lexicon) OST275420 (lexicon) OST273448 (lexicon) OST263229 (lexicon)
OST260882 (lexicon) OST248811 (lexicon) OST240233 (lexicon) OST232813 (lexicon)
OST225699 (lexicon) OST218830 (lexicon) OST210206 (lexicon) OST204126 (lexicon)
OST190854 (lexicon) OST188288 (lexicon) OST182601 (lexicon) OST173950 (lexicon)
OST173497 (lexicon) OST167999 (lexicon) OST154476 (lexicon) OST148474 (lexicon)
OST142154 (lexicon) OST137832 (lexicon) OST132037 (lexicon) OST130015 (lexicon)
OST129735 (lexicon) OST129639 (lexicon) OST122750 (lexicon) OST91563 (lexicon)
OST81108 (lexicon) OST65369 (lexicon) OST45661 (lexicon) OST37122 (lexicon)
OST36999 (lexicon) OST34894 (lexicon) OST34509 (lexicon) OST33593 (lexicon)
OST33292 (lexicon) OST32798 (lexicon) OST17201 (lexicon) OST3051 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000629372 (Chr1:84836420..84836543 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTGTTGATCACCCGGACTC Chr1:84836522..84836541 60.37 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000629372 (Chr1:84836420..84836543 +)
Downstram Exon
ENSMUSE00000629370 (Chr1:84877667..84877775 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTGTTGATCACCCGGACTC Chr1:84836522..84836541 60.37 55 CCAGGTTTTGCTGACCGATA Chr1:84877728..84877747 61.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000629372 Chr1:84836420..84836543 GTTGTTGATCACCCGGACTC Chr1:84836522..84836541 60.37 55

*** Putative Vector Insertion (Chr 1: 84836544 - 84877666) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000629370 Chr1:84877667..84877775 CCAGGTTTTGCTGACCGATA Chr1:84877728..84877747 61.02 50
downstream ENSMUSE00000629369 Chr1:84893065..84893237 CTTCGCACAGGTTGAAGACA Chr1:84893127..84893146 60.03 50
downstream ENSMUSE00000629368 Chr1:84896572..84897059 TAGTACTTGGGCCCTGGTTG Chr1:84896952..84896971 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAAGGCAACATTTGCAAGC Chr1:84854510..84854530 60.25 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAAGGCAACATTTGCAAGC Chr1:84854510..84854530 60.25 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073633