Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1307
Trapped Gene
Ptk7 (ENSMUSG00000023972)
Vector Insertion
Chr 17: 46728463 - 46766454
Public Clones (sanger) (sanger) DC0144 (sanger) G074E05 (ggtc) 5SE122E11 (ggtc)
5SE324B02 (ggtc) 3SE122E11 (ggtc) (ggtc) 5SE323A11 (ggtc) 5SD054H06 (ggtc)
5SD175F06 (ggtc) (ggtc) 3SE323A11 (ggtc) (cmhd) (cmhd)
CMHD-GT_372C12-3 (cmhd) (cmhd) CMHD-GT_408A1-3 (cmhd) IST15079C5 (tigm)
IST14581C9 (tigm) IST14579E5 (tigm) IST14044B4 (tigm)
Private Clones OST258376 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695575 (Chr17:46766217..46766453 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTCTGCTCAGAGCCCTGCT Chr17:46766234..46766253 61.82 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695575 (Chr17:46766217..46766453 -)
Downstram Exon
ENSMUSE00000434760 (Chr17:46728464..46728751 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTCTGCTCAGAGCCCTGCT Chr17:46766234..46766253 61.82 60 GTTATCCCGAGCCACACACT Chr17:46728491..46728510 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695575 Chr17:46766217..46766453 ACTCTGCTCAGAGCCCTGCT Chr17:46766234..46766253 61.82 60
upstream ENSMUSE00000434760 Chr17:46728464..46728751 AGTGTGTGGCTCGGGATAAC Chr17:46728513..46728532 60 55

*** Putative Vector Insertion (Chr 17: 46728463 - 46766454) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434756 Chr17:46727708..46727810 GTGACATCGCAGTGTGACCT Chr17:46727703..46727722 59.74 55
downstream ENSMUSE00000434752 Chr17:46727210..46727400 CGGAACCACTGGTAGGTAGG Chr17:46727358..46727377 59.47 60
downstream ENSMUSE00000434750 Chr17:46726961..46727111 GTGATGGGAGTCTCGTCCTC Chr17:46726951..46726970 59.64 60
downstream ENSMUSE00000434748 Chr17:46723663..46723811 AGAGAGCCATTGGCAAACAC Chr17:46723745..46723764 60.26 50
downstream ENSMUSE00000434744 Chr17:46723150..46723416 TCACTCTCAGCGATGGTGAC Chr17:46723202..46723221 59.99 55
downstream ENSMUSE00000434742 Chr17:46716516..46716649 CTCTTCCAGCTGGCTGTCTT Chr17:46716581..46716600 59.74 55
downstream ENSMUSE00000434739 Chr17:46716242..46716377 GTACTGCTCACGCAACGGTA Chr17:46716264..46716283 59.94 55
downstream ENSMUSE00000434734 Chr17:46715999..46716118 GCACCGTAGCCTCCTTATCA Chr17:46716028..46716047 60.24 55
downstream ENSMUSE00000434730 Chr17:46713710..46713859 AGCATCATCTCGGGTCACTC Chr17:46713761..46713780 60.23 55
downstream ENSMUSE00000369729 Chr17:46713441..46713591 AGCTTGGTAGGGTCCAGGAT Chr17:46713428..46713447 59.96 55
downstream ENSMUSE00000327286 Chr17:46713213..46713340 AGGGAACCGTTCTGGAAGAT Chr17:46713292..46713311 59.94 50
downstream ENSMUSE00000327263 Chr17:46711221..46711424 TTGGCTTTACACCGCTTCTT Chr17:46711252..46711271 59.88 45
downstream ENSMUSE00000327240 Chr17:46710369..46710524 CTCTCGGGAAATGCATCCTA Chr17:46710374..46710393 60.17 50
downstream ENSMUSE00000327217 Chr17:46709471..46709703 TCAACTTCCCGAACATCTCC Chr17:46709529..46709548 60.05 50
downstream ENSMUSE00000327627 Chr17:46708552..46708632 GAGGGGCTGTGACTTCAACT Chr17:46708545..46708564 59.31 55
downstream ENSMUSE00000327604 Chr17:46704874..46705025 ACAAAGCGGTTGTTGGACAG Chr17:46704945..46704964 61.12 50
downstream ENSMUSE00000327583 Chr17:46703052..46703230 GAGACATCCAACGCAGAGGT Chr17:46703159..46703178 60.27 55
downstream ENSMUSE00000657269 Chr17:46701423..46702444 CCTAGGCACTGCCAGTCTTC Chr17:46702109..46702128 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr17:46745386..46745406 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATGTCGTGACTGGGAAAA Chr17:46745389..46745409 60.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGATGCTCATGTCCCTTTGA Chr17:46736220..46736240 60.2 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGATGCTCATGTCCCTTTGA Chr17:46736220..46736240 60.2 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023972