Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13070
Trapped Gene
Pacsin1 (ENSMUSG00000040276)
Vector Insertion
Chr 17: 27839802 - 27841789
Public Clones CMHD-GT_344H8-3 (cmhd) IST14467E6 (tigm) IST13333B3 (tigm) IST12886F10 (tigm)
Private Clones OST277561 (lexicon) OST147587 (lexicon) OST119358 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000460033 (Chr17:27839645..27839801 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTACAAGCGGACGGTGAAG Chr17:27839652..27839671 60.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000460033 (Chr17:27839645..27839801 +)
Downstram Exon
ENSMUSE00000460027 (Chr17:27841790..27842025 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTACAAGCGGACGGTGAAG Chr17:27839652..27839671 60.31 55 AGCTCGCTGACCTTATCTGC Chr17:27841862..27841881 59.75 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700859 Chr17:27792454..27792704 CCTTCTCCTCCTCCTTTTCC Chr17:27792584..27792603 59.25 55
upstream ENSMUSE00000460067 Chr17:27792533..27792704 CCTTCTCCTCCTCCTTTTCC Chr17:27792584..27792603 59.25 55
upstream ENSMUSE00000700854 Chr17:27792588..27792704 TCCTCCTCCTTTTCCTCCTC Chr17:27792589..27792608 59.75 55
upstream ENSMUSE00000657940 Chr17:27822199..27822370 No primer for this exon
upstream ENSMUSE00000700857 Chr17:27838677..27838886 CCATGTCTGGCTCCTACGAT Chr17:27838831..27838850 60.1 55
upstream ENSMUSE00000460051 Chr17:27838712..27838886 CCATGTCTGGCTCCTACGAT Chr17:27838831..27838850 60.1 55
upstream ENSMUSE00000715728 Chr17:27838712..27838886 CCATGTCTGGCTCCTACGAT Chr17:27838831..27838850 60.1 55
upstream ENSMUSE00000700853 Chr17:27838771..27838886 GTCTGGCTCCTACGATGAGG Chr17:27838835..27838854 59.83 60
upstream ENSMUSE00000460033 Chr17:27839645..27839801 ACTACAAGCGGACGGTGAAG Chr17:27839652..27839671 60.31 55

*** Putative Vector Insertion (Chr 17: 27839802 - 27841789) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000460027 Chr17:27841790..27842025 AGCTCGCTGACCTTATCTGC Chr17:27841862..27841881 59.75 55
downstream ENSMUSE00000460023 Chr17:27842570..27842725 TGCATTTGTCCACTTTGTCC Chr17:27842711..27842730 59.55 45
downstream ENSMUSE00000460015 Chr17:27842862..27843037 AGGTTGAGATGCCGTTTGAT Chr17:27843025..27843044 59.56 45
downstream ENSMUSE00000245756 Chr17:27843939..27844059 TCCAGTTCTCGGTAGACATGC Chr17:27843967..27843987 60.27 52.38
downstream ENSMUSE00000245736 Chr17:27844164..27844291 CTCCTTCTTGGCAGTGGTGT Chr17:27844208..27844227 60.3 55
downstream ENSMUSE00000459997 Chr17:27844825..27845012 CACTCGGTGGCATATGTTTG Chr17:27844869..27844888 59.99 50
downstream ENSMUSE00000348638 Chr17:27845371..27848051 GCCAGGTGAGAGCCTTGTAG Chr17:27846458..27846477 60.01 60
downstream ENSMUSE00000657939 Chr17:27845371..27845604 CACCAACCCTGTTCGTCTTC Chr17:27845419..27845438 60.54 55
downstream ENSMUSE00000700852 Chr17:27845371..27845622 CACCAACCCTGTTCGTCTTC Chr17:27845419..27845438 60.54 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATAATCGCCTTGCAGCACA Chr17:27839851..27839871 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCAGCTCATCGAGAAAGGT Chr17:27839785..27839805 61.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040276