Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13108
Trapped Gene
Ctnnal1 (ENSMUSG00000038816)
Vector Insertion
Chr 4: 56857507 - 56860681
Public Clones CMHD-GT_330A6-3 (cmhd) CMHD-GT_430H6-3 (cmhd) IST12406F3 (tigm) IST12708D4 (tigm)
IST12382G4 (tigm) IST14392G7 (tigm) IST12708D4BBF2 (tigm)
Private Clones OST390863 (lexicon) OST389830 (lexicon) OST374144 (lexicon) OST138055 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000327758 (Chr4:56860682..56860871 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACGAAAACTGGGATTTG Chr4:56860725..56860744 60.34 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000327758 (Chr4:56860682..56860871 -)
Downstram Exon
ENSMUSE00000327753 (Chr4:56857319..56857506 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACGAAAACTGGGATTTG Chr4:56860725..56860744 60.34 45 TCAGAATCGTGACCTGACCA Chr4:56857410..56857429 60.25 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000327764 Chr4:56877849..56878060 GAGCTGTCCACTCCTCCAAC Chr4:56877930..56877949 59.84 60
upstream ENSMUSE00000327758 Chr4:56860682..56860871 CCAACGAAAACTGGGATTTG Chr4:56860725..56860744 60.34 45

*** Putative Vector Insertion (Chr 4: 56857507 - 56860681) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000327753 Chr4:56857319..56857506 TCAGAATCGTGACCTGACCA Chr4:56857410..56857429 60.25 50
downstream ENSMUSE00000327748 Chr4:56854433..56854552 CTTTCCATGGTTGCGAGAAT Chr4:56854511..56854530 60.07 45
downstream ENSMUSE00000673892 Chr4:56853768..56853791 No primer for this exon
downstream ENSMUSE00000327741 Chr4:56851838..56851927 TCGTACCCTTTTCAAGCACA Chr4:56851839..56851858 59.32 45
downstream ENSMUSE00000360347 Chr4:56850604..56850774 TGCAGTCAGTCACGATCTCC Chr4:56850644..56850663 59.99 55
downstream ENSMUSE00000446507 Chr4:56848050..56848250 GTCCTCGCCTGAGAAGACAG Chr4:56848065..56848084 60.13 60
downstream ENSMUSE00000368750 Chr4:56845778..56845864 TCTCTCCTCAGCTCGTCCAG Chr4:56845757..56845776 60.84 60
downstream ENSMUSE00000327706 Chr4:56842356..56842514 ACTCAGCCAAAGCTTCCAAA Chr4:56842375..56842394 59.99 45
downstream ENSMUSE00000327698 Chr4:56840124..56840216 TATATGCCGCAACAATCGAC Chr4:56840171..56840190 59.55 45
downstream ENSMUSE00000327689 Chr4:56839146..56839296 TAGACGGATGCAACGTCAAC Chr4:56839235..56839254 59.72 50
downstream ENSMUSE00000327683 Chr4:56835390..56835427 AGTGAAAGATGGTCGCACCT Chr4:56835381..56835400 59.73 50
downstream ENSMUSE00000327672 Chr4:56830119..56830169 GTCAGGTTTGTCGGGCTTTA Chr4:56830103..56830122 60.11 50
downstream ENSMUSE00000327664 Chr4:56829861..56830015 GAGAGCAATCCCAGCTTCAG Chr4:56829947..56829966 60.1 55
downstream ENSMUSE00000327659 Chr4:56829053..56829101 TCCTGGGAAGTTTTCAGTGG Chr4:56829050..56829069 60.08 50
downstream ENSMUSE00000327653 Chr4:56826702..56826758 No primer for this exon
downstream ENSMUSE00000327645 Chr4:56826050..56826163 AAGCTGGTGGCATAGAGGAA Chr4:56826073..56826092 59.84 50
downstream ENSMUSE00000327639 Chr4:56825383..56825466 GGAGCTGGACCACAAGAGTC Chr4:56825390..56825409 59.84 60
downstream ENSMUSE00000327634 Chr4:56823809..56825260 AGAAGAGTCCACAGGCCTCA Chr4:56824776..56824795 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAAATTAACATCGCCTGCAT Chr4:56857697..56857719 60 36.36 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAAATTAACATCGCCTGCAT Chr4:56857697..56857719 60 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAATAATCGCCTTGCAGCAC Chr4:56857804..56857824 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATAAAACGTGACTGGGAAAACC Chr4:56857805..56857827 59.29 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038816