Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13109
Trapped Gene
Atg10 (ENSMUSG00000021619)
Vector Insertion
Chr 13: 91293918 - 91347922
Public Clones CMHD-GT_327A2-3 (cmhd) IST11286G12 (tigm) IST11286G12 (tigm)
Private Clones OST300481 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000412805 (Chr13:91347923..91348038 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCACAGCAGATAGGCGATG Chr13:91347946..91347965 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000412805 (Chr13:91347923..91348038 -)
Downstram Exon
ENSMUSE00000119478 (Chr13:91293822..91293917 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCACAGCAGATAGGCGATG Chr13:91347946..91347965 59.97 50 GCATGTGGTGTCAAGGTCTC Chr13:91293828..91293847 59.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454489 Chr13:91363544..91363592 No primer for this exon
upstream ENSMUSE00000412805 Chr13:91347923..91348038 TTCACAGCAGATAGGCGATG Chr13:91347946..91347965 59.97 50

*** Putative Vector Insertion (Chr 13: 91293918 - 91347922) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000119478 Chr13:91293822..91293917 GCATGTGGTGTCAAGGTCTC Chr13:91293828..91293847 59.1 55
downstream ENSMUSE00000228963 Chr13:91180455..91180593 CTGCAGGTCTCGTCACTTCA Chr13:91180523..91180542 60.18 55
downstream ENSMUSE00000228956 Chr13:91162175..91162272 CAGCCTCGGCTTATAGCACT Chr13:91162186..91162205 59.64 55
downstream ENSMUSE00000680664 Chr13:91162097..91162114 No primer for this exon
downstream ENSMUSE00000228946 Chr13:91076898..91076995 TGGTTGCCCAAGTATTGGAT Chr13:91076950..91076969 60.19 45
downstream ENSMUSE00000381803 Chr13:91076192..91076307 CACTCCGATTGTGATGTTGC Chr13:91076187..91076206 60.12 50
downstream ENSMUSE00000341031 Chr13:91074954..91075850 AACAGAGCAGTCGTGGGTCT Chr13:91075095..91075114 59.91 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTTTGTGTAATCGCCTTG Chr13:91341860..91341880 59.58 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTTAAAATCAGCGACTGC Chr13:91341938..91341958 58.92 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGACATGTAATCGCCTTGC Chr13:91341976..91341996 59.16 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCATAGGCTGGTTTCGTGAC Chr13:91341982..91342002 60.67 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021619